SUPERCOMPUTER EDUCATION & RESEARCH CENTRE
PDB Anonymous FTP Server
INDIAN INSTITUTE OF SCIENCE
BANGALORE - 560 012

173 New atomic coordinate entries downloaded from RCSB on  21 september 2017


The following are the new PDB-ids downloaded this week :

 5gvz   5gwv   5gww   5gwy   5gxd   5gxe   5gxf   5h5l   5h6b   5h6g   5knp   5knq   5kny   5lsn   5lt9   5ltd   5ltg   5ltm   5lto   5ltu   5ltv   5ltx   5lu0   5luc   5lue   5lug   5lur   5lv2   5lv3   5lv4   5lv5   5lxs   5ly9   5m24   5m4t   5mcb   5mf2   5mf4   5mtc   5mtd   5mvr   5n5d   5n63   5n64   5n65   5n66   5n67   5n68   5nh1   5nr5   5nr6   5nsw   5nt5   5nvv   5nvw   5nvx   5nvy   5nvz   5nw0   5nw1   5nw2   5nx4   5nx5   5nx6   5nx7   5nyz   5nz2   5o1q   5o2m   5o2p   5o2q   5o2w   5o2x   5o45   5o4y   5o83   5oca   5oey   5oez   5ofu   5ohk   5ohn   5ohp   5ooq   5owx   5oxg   5oy3   5oy7   5oyi   5t7m   5t7o   5t84   5t8a   5tbh   5tbi   5tbj   5tcb   5tce   5tcl   5tcv   5tcw   5td6   5tsa   5tsb   5ttp   5tv3   5tv4   5tvb   5tw2   5tw5   5u4u   5u4v   5u64   5u65   5u99   5ubx   5ugz   5ush   5usi   5usl   5v4b   5v7q   5vem   5ven   5veo   5vhg   5vid   5vko   5vlb   5vlc   5vld   5vmr   5w3p   5w56   5w57   5wjl   5wjn   5wkf   5wkh   5x1a   5x1c   5x1d   5x2r   5x2t   5x4a   5xau   5xjj   5xki   5xnl   5xnm   5xnn   5xno   5xpt   5xpu   5xuv   5xxy   5y48   5y4i   5y4j   5y61   5y62   5y7y   5y91   5ydb   6alt   6amr   6anj   6ank   6ar7   6atz   6avl   6ay1 

2001 modified atomic coordinate entries downloaded from RCSB on  21 september 2017


The following are the modified PDB-ids downloaded this week :

 1hh8   2fwv   2n9a   3gqo   3kw3   3s6l   3tgx   4e0l   4gnd   4h05   4hec   4hjh   4hu9   4i1m   4ib6   4ib7   4ib8   4jfb   4mmr   4mms   4mmu   4mmv   4nds   4nnt   4nwp   4owp   4owr   4ox2   4oxi   4oxs   4oxx   4oz0   4oz1   4p1e   4p1l   4p1m   4p2h   4p2o   4p2q   4p2t   4p31   4p32   4p33   4p3h   4p4g   4p4l   4p4n   4p53   4p66   4p68   4p6j   4p6k   4p6l   4p7t   4p8b   4p96   4p97   4p9k   4p9o   4p9p   4p9u   4pa3   4pa4   4pa6   4pa7   4pa9   4par   4pb1   4pb2   4pbr   4pbs   4pbt   4pcv   4pd5   4pd6   4pd7   4pd8   4pd9   4pda   4pdj   4pdk   4pgn   4pgq   4pgr   4pgu   4pgv   4pgw   4pgx   4pgy   4ph5   4pha   4phd   4phe   4php   4pht   4pix   4piy   4piz   4pjy   4pjz   4pk0   4pk2   4pk3   4plx   4pmi   4pmj   4pmw   4tkn   4tn0   4tn7   4tnm   4to9   4toa   4tob   4toc   4tod   4toe   4tof   4tog   4toh   4tor   4tos   4tpy   4trj   4trk   4tse   4tt5   4ttb   4ttc   4tu8   4tu9   4tup   4tuq   4tur   4tus   4tuv   4tuw   4tux   4tv0   4tvq   4tvt   4twr   4tx9   4tzj   4tzk   4tzl   4tzm   4tzn   4tzo   4tzq   4tzr   4tzs   4tzt   4u0j   4u0k   4u12   4u13   4u21   4u2y   4u2z   4u31   4u33   4u3c   4u64   4u65   4u7m   4u8h   4u9p   4uad   4uae   4uaf   4ube   4w4v   4w4w   4w4x   4w4y   4w61   4w6z   4w78   4w7s   4w8f   4w8q   4w8s   4w8t   4wal   4wam   4wan   4wbb   4wd1   4whx   4wii   4wij   4wik   4wkb   4wkc   4wkn   4wko   4wkp   4wlp   4wlq   4wlr   4wls   4wlw   4wm7   4wm8   4wmz   4wnb   4wo6   4wo9   4woa   4wob   4woc   4wor   4wpb   4wpd   4wqj   4wr9   4wrc   4wre   4wrf   4wsz   4wt0   4wu4   4wuh   4wui   4wul   4wuw   4wux   4wv3   4wv9   4wvh   4wvi   4wwk   4wy2   4wy4   4wyn   4wyp   4wyz   4wz0   4wz2   4wz3   4x0o   4x1j   4x24   4x28   4x2q   4x2r   4x2t   4x2u   4x4j   4x67   4x6a   4x6q   4x6r   4x7w   4x9k   4x9o   4x9r   4x9x   4xa8   4xa9   4xbh   4xdi   4xe6   4xea   4xec   4xed   4xf9   4xfa   4xfb   4xfc   4xff   4xfg   4xfh   4xfi   4xfs   4xft   4xfu   4xfx   4xfy   4xfz   4xgc   4xgu   4xi6   4xi7   4xib   4xjv   4xk2   4xl1   4xln   4xlp   4xlq   4xlv   4xlw   4xmk   4xml   4xmm   4xno   4xo0   4xpc   4xpe   4xpv   4xpz   4xq0   4xq4   4xqd   4xqw   4xr9   4xtr   4xv4   4xv5   4xv6   4xv7   4xv8   4xva   4xvu   4xvv   4xwo   4xzr   4y0i   4y1i   4y1j   4y1l   4y1m   4y3u   4y52   4y5j   4y5q   4y5r   4y6w   4y7c   4y7n   4y7r   4y86   4y87   4y8w   4y9r   4y9u   4yaf   4yal   4yao   4yau   4yaw   4ybl   4ybr   4yc2   4ycu   4ycv   4ycw   4ycx   4ycz   4yd1   4yd2   4yd8   4yds   4ye5   4yer   4yeu   4yfk   4yfn   4yfs   4yg2   4yga   4ygo   4yhx   4yi0   4yi8   4yi9   4yic   4yis   4yit   4yiv   4yiz   4yj2   4yj3   4yjm   4yjn   4yjx   4yka   4ylh   4ylm   4ylr   4yls   4ylu   4yml   4yn0   4yno   4ynr   4yo8   4yo9   4yoe   4yog   4yoi   4yoj   4yoo   4yos   4yoz   4yp3   4yqw   4yr0   4yr2   4yr3   4ys0   4ys3   4ys4   4ysj   4ysm   4yuq   4yw8   4yw9   4ywb   4ywd   4ywk   4ywl   4ywm   4yyf   4yyx   4yz0   4yza   4yzb   4yzq   4yzx   4z03   4z05   4z06   4z0u   4z1t   4z1u   4z1x   4z1z   4z3j   4z3t   4z3u   4z4c   4z4d   4z4e   4z4g   4z4h   4z4i   4z5p   4z5q   4z66   4z6l   4z6m   4z6n   4z6o   4z6p   4z6q   4z6r   4z6s   4z6t   4z6u   4z6v   4z6w   4z6z   4z79   4z7k   4z7x   4z80   4z81   4z8l   4z8q   4z8t   4z8u   4z8v   4zai   4zbf   4zbk   4zbo   4zbt   4zc6   4zce   4zcf   4zcg   4zd4   4zd5   4zdl   4zdo   4zdp   4zdw   4zf3   4zf4   4zf5   4zfr   4zft   4zhn   4zie   4zif   4zig   4zih   4zii   4zip   4zix   4zjm   4zkq   4zl4   4zlp   4zlt   4zm9   4zn6   4znp   4zro   4zrr   4zst   4zsw   4zth   4ztk   4zto   4ztp   4zud   4zuy   4zv0   4zv4   4zvo   4zvp   4zvq   4zvr   4zvs   4zvt   4zvu   4zwe   4zwg   4zwi   4zwo   4zxs   4zxz   4zyl   4zym   4zyn   4zyr   4zyt   4zyu   4zyv   4zyw   4zyx   4zyy   4zyz   4zz0   4zz1   4zz2   4zz3   5bny   5bo8   5bp5   5bqd   5bqf   5bql   5bqu   5brk   5brm   5bry   5bs4   5bs7   5bta   5btb   5btc   5btd   5bte   5btf   5btg   5bth   5bti   5btl   5btn   5bto   5btx   5bty   5btz   5bu0   5bu1   5bu2   5bud   5bv1   5bw0   5bw9   5bwj   5bwz   5bx1   5bxv   5byt   5c1r   5c39   5c3c   5c46   5c4g   5c4i   5c5g   5c5k   5c6c   5c6e   5c6n   5c6o   5c6p   5c7l   5c8a   5c8d   5c8e   5c8f   5c8i   5c9h   5c9s   5ca6   5caj   5cam   5caz   5cb7   5cbf   5cbg   5cbh   5cbx   5cby   5cbz   5cc0   5cc1   5cd4   5cek   5cg0   5cgn   5cgo   5cgv   5cgy   5chn   5ci0   5ci1   5ci2   5ci3   5ci4   5cjp   5cku   5clf   5clg   5clh   5cli   5clj   5cmq   5cmr   5cnp   5cns   5cnt   5cnu   5cnv   5cos   5cpb   5cr9   5crg   5crh   5cs0   5cs4   5csa   5csk   5csl   5cuf   5cvu   5cvv   5cy1   5cy2   5cys   5cyv   5cyz   5czo   5d08   5d0a   5d0b   5d1n   5d1y   5d27   5d2c   5d3g   5d3o   5d3v   5d3w   5d3x   5d3y   5d4g   5d5h   5d5l   5d6r   5d6w   5d6x   5d6y   5d7e   5d80   5d8c   5d8n   5d9g   5d9i   5dag   5dah   5das   5db4   5dbs   5dc0   5dc4   5dcf   5dd0   5dd1   5dd3   5dd5   5dd6   5ddk   5ddo   5ddp   5ddr   5deo   5dez   5df0   5dff   5dfh   5dfi   5dft   5dgc   5dgh   5dgi   5dgy   5dh0   5dh1   5dh2   5dh9   5dha   5dhf   5dhi   5dhk   5di9   5dif   5dj5   5dk4   5dkf   5dkp   5dli   5dml   5dmn   5dn4   5dn5   5dn9   5do5   5dob   5doc   5doe   5dpg   5dph   5dpi   5dpj   5dq8   5dqe   5dqn   5dro   5drp   5drq   5drr   5dsg   5dsy   5du0   5du2   5du7   5duj   5dvp   5dvz   5dw0   5dw3   5dwu   5dx6   5dyh   5dyo   5dzg   5dzj   5dzp   5e02   5e0k   5e1g   5e1i   5e3e   5e5l   5e6g   5e7n   5e84   5e85   5e86   5eao   5ebv   5ec4   5ecj   5ed7   5eeg   5eeh   5efi   5eg2   5eg5   5eg6   5egc   5eh4   5eh6   5ehk   5eim   5eip   5eiu   5ejb   5ekd   5eki   5ekn   5eko   5en9   5ena   5eov   5eq2   5eq3   5eq4   5eqd   5eqf   5eqx   5er9   5erd   5erf   5erm   5ern   5ero   5erp   5es2   5esf   5esg   5esh   5esi   5esj   5esk   5esl   5esm   5esn   5evj   5ewn   5exr   5f0q   5f0s   5f3r   5f4y   5f5p   5fap   5fas   5fau   5fav   5faw   5fay   5fc4   5fc9   5fd7   5fd9   5fdo   5fdr   5feu   5ff8   5ff9   5fff   5ffp   5ffr   5ffs   5fft   5fg0   5fg1   5fgu   5fgw   5fgz   5fh0   5fh1   5fh2   5fh3   5fh4   5fh5   5fi0   5fi1   5fi2   5fi6   5fi7   5g5k   5gun   5gv1   5gxb   5gy8   5gy9   5gya   5gyb   5gyc   5gye   5gyf   5gyh   5gyi   5h1b   5h48   5h49   5h4b   5h4c   5h8a   5hav   5hax   5hay   5haz   5hb0   5hb1   5hb2   5hb3   5hb4   5hb5   5hb6   5hb7   5hb8   5hbm   5he8   5hev   5hf0   5hf2   5hf7   5hft   5hgj   5hgu   5hgv   5hhc   5hhd   5hhu   5hi0   5hkq   5hkw   5hkx   5hky   5hkz   5hl0   5hl1   5hl9   5hla   5hlb   5hld   5hlf   5hm9   5hma   5hn1   5hn7   5hn8   5hn9   5hna   5hou   5hp0   5hp1   5hpb   5hpd   5hpn   5hpp   5hqg   5hqy   5hqz   5hro   5hry   5hrz   5hs0   5ht2   5hus   5hut   5huu   5huv   5huw   5huy   5hvi   5hvl   5hvm   5hvo   5hw1   5hw5   5hx0   5hx7   5hyh   5hyo   5hys   5i01   5i0a   5i1n   5i1o   5i1p   5i1s   5i1u   5i2x   5i2y   5i30   5i36   5i3u   5i42   5i47   5i4k   5i4q   5i4r   5i4t   5i52   5i56   5i57   5i58   5i59   5i61   5i62   5i63   5i6q   5i6t   5i72   5i7j   5i7k   5i7l   5i8c   5i8d   5i8e   5i8h   5i90   5i94   5i96   5ibv   5ic0   5ic1   5ic4   5ic5   5idl   5iez   5if4   5ihs   5iih   5iiu   5iiw   5iix   5iiy   5ij1   5ij2   5ij3   5ij4   5ij5   5ije   5ijf   5ijn   5ijo   5ikn   5iku   5ils   5ilu   5ilv   5imi   5imn   5imp   5in8   5ine   5ink   5inl   5inm   5inn   5ino   5inp   5inq   5inz   5iob   5ion   5ioq   5ior   5ios   5iot   5iq8   5iqw   5iqx   5ir2   5irb   5irc   5iry   5isp   5isq   5ist   5isw   5isx   5isz   5it5   5iut   5iuy   5iv0   5iv1   5ivg   5iw7   5iwd   5iwk   5iwp   5iwr   5iws   5iwt   5ix8   5ix9   5ixa   5ixe   5ixj   5izn   5izq   5j0h   5j0z   5j17   5j1e   5j1s   5j1t   5j23   5j2m   5j2n   5j2p   5j2q   5j5e   5j5j   5j63   5j6a   5j6g   5j6h   5j6z   5j71   5j7m   5j8d   5j8g   5j8h   5j9f   5ja1   5ja2   5ja3   5jbl   5jbm   5jbs   5jcv   5jdf   5jdg   5jdh   5jdl   5jdm   5jdn   5jdq   5jdv   5jdy   5jdz   5je0   5je1   5je2   5je3   5je4   5je5   5je6   5je7   5jeg   5jes   5jg0   5jhd   5ji2   5jir   5jj6   5jk2   5jkq   5jlc   5jlj   5jlw   5jlx   5jm7   5jm8   5jn5   5jn6   5jn8   5jn9   5jna   5jnc   5jne   5jnr   5jns   5jnt   5jnu   5jnv   5jnw   5jqe   5jqh   5jqu   5jqv   5jr2   5jr3   5jrw   5jsb   5jtf   5jtg   5juh   5jum   5jwn   5jwo   5jwq   5jwr   5jx0   5jx3   5jx7   5jx8   5jyn   5jyq   5jyt   5jyu   5jyv   5jze   5k08   5k19   5k1a   5k1b   5k20   5k21   5k34   5k35   5k36   5k4b   5k4c   5k4d   5k5h   5k5i   5k5j   5k5l   5k5s   5k5t   5k69   5k74   5k79   5k8b   5k8c   5k8h   5k8k   5k93   5k94   5k9b   5k9v   5k9w   5ka0   5kcb   5kci   5kcm   5kd1   5kdg   5kdq   5ke6   5ke7   5ke8   5ke9   5kea   5keb   5keh   5kes   5kf3   5kf6   5kf7   5kfa   5kfb   5kfc   5kfd   5kfe   5kff   5kfg   5kfh   5kfi   5kfj   5kfk   5kfl   5kfm   5kfn   5kfo   5kfp   5kfq   5kfr   5kfs   5kft   5kfu   5kfv   5kfw   5kfx   5kfy   5kfz   5kg0   5kg1   5kg2   5kg3   5kg4   5kg5   5kg6   5kg7   5kgs   5kgt   5kgy   5kgz   5kh8   5ki0   5kik   5kil   5kiq   5kiz   5kj3   5kj4   5kja   5kjd   5kjg   5kjs   5kjt   5kju   5kjv   5kjw   5kjx   5kjy   5kjz   5kk3   5kk9   5kkb   5kkd   5kkf   5kkq   5kkr   5kkv   5klu   5kmz   5knl   5knw   5ko3   5koh   5kow   5kox   5kp1   5kp2   5kp3   5kp4   5kp5   5kp6   5kp7   5kp8   5kpe   5kq1   5kq4   5kqj   5kqx   5kqy   5kqz   5kr0   5kr1   5kr2   5krb   5krg   5krq   5krt   5krw   5ks2   5ks6   5ksc   5ksq   5ksr   5kss   5kst   5ktf   5ktk   5ktm   5ktn   5kto   5ktp   5ktr   5kts   5ktt   5ku5   5kue   5kug   5kui   5kuj   5kvl   5kvq   5kvs   5kwd   5kxb   5kxc   5kxd   5kxe   5kxh   5kxq   5ky0   5ky2   5kyt   5kyv   5kzf   5kzj   5l06   5l07   5l09   5l0l   5l0m   5l0o   5l11   5l13   5l1b   5l1i   5l1j   5l1k   5l1l   5l1z   5l24   5l2g   5l2m   5l2n   5l2o   5l2q   5l2r   5lga   5lp6   5ls2   5ls7   5m49   5m4b   5m4g   5m4j   5m4l   5m4q   5mfj   5mmq   5mmx   5mn0   5moa   5mob   5mtx   5mty   5myd   5myf   5myi   5n6y   5n8f   5n8g   5n8h   5n8i   5n92   5nan   5ne1   5ne2   5ne3   5njl   5nlc   5nm8   5nuh   5nui   5nv3   5nzs   5o4w   5o4x   5oej   5oho   5ohq   5oj6   5okz   5onc   5one   5ool   5oom   5oqv   5ov9   5suo   5suw   5sux   5sv8   5svb   5svc   5svd   5sve   5svj   5svp   5svq   5svr   5svs   5svt   5sw8   5swa   5swb   5swg   5swi   5swo   5swp   5swr   5swt   5sww   5sx8   5sx9   5sxa   5sxb   5sxc   5sxd   5sxe   5sxf   5sxi   5sxj   5sxk   5sy8   5sym   5syn   5sz8   5szd   5sze   5szl   5szm   5szn   5szo   5szp   5szr   5szs   5t03   5t05   5t09   5t0a   5t0f   5t0k   5t0m   5t0q   5t1d   5t1o   5t29   5t2y   5t3m   5t3n   5t3z   5t4m   5t4n   5t4w   5t5b   5t6l   5t7h   5t80   5t82   5t85   5t8u   5t8z   5t90   5t93   5t9p   5tab   5tb7   5tbn   5tbo   5tby   5tbz   5tc9   5tca   5tcc   5tct   5td7   5tda   5tdb   5tdc   5tdd   5tdt   5tdu   5tdv   5tdy   5te2   5te8   5tfw   5tfy   5tg4   5tg5   5tg6   5tg7   5tg8   5tg9   5tgg   5tgn   5tgo   5tgq   5tgu   5tgx   5th0   5th1   5th3   5th4   5thb   5thc   5thf   5thj   5thn   5thq   5thy   5thz   5ti0   5ti2   5ti3   5ti4   5ti5   5ti6   5ti7   5tib   5tj2   5tj4   5tj5   5tkf   5tkg   5tkh   5tki   5tkm   5tkv   5tme   5tod   5tph   5tpj   5tpw   5tpz   5tq0   5tq2   5tqb   5tqc   5tql   5trc   5trn   5trv   5ts4   5tsc   5tsd   5tsj   5tt5   5ttb   5ttc   5tth   5ttt   5tty   5tu7   5tu8   5tu9   5tua   5tuq   5tuw   5tux   5tv0   5tvd   5tvi   5tvj   5tw1   5twp   5twq   5twr   5tws   5txl   5txm   5txn   5txo   5txp   5txv   5tzk   5tzl   5u02   5u1l   5u1u   5u1v   5u1w   5u1x   5u1y   5u2h   5u2k   5u2l   5u2p   5u2u   5u30   5u31   5u33   5u34   5u36   5u3f   5u4p   5u55   5u59   5u5a   5u5b   5u5c   5u5g   5u5u   5u5v   5u5w   5u5x   5u5y   5u5z   5u60   5u61   5u63   5u6y   5u75   5u79   5u7m   5u7o   5u8g   5u8h   5u8i   5u8j   5u8s   5u8t   5ua4   5ua5   5uac   5uag   5uah   5uaj   5ual   5uaq   5uat   5uau   5uav   5uaw   5uax   5ub8   5ubc   5uc0   5uc2   5ucg   5ucw   5udb   5udo   5ue6   5uf5   5uf8   5ufk   5ug2   5ug3   5ug5   5uh5   5uhw   5uhz   5ui9   5uia   5uib   5uij   5uik   5uil   5uim   5uin   5uj3   5uj4   5uj7   5ujp   5uk5   5ukm   5ul5   5ul8   5ulg   5ulw   5ulx   5um1   5um3   5um9   5umi   5un3   5un7   5unc   5und   5unj   5upu   5upv   5upx   5upy   5uqf   5uqg   5uqh   5uqk   5uql   5uqm   5uqn   5uqp   5uqt   5urq   5urr   5urs   5us1   5usc   5usf   5usr   5utk   5utt   5uu6   5uu8   5uuv   5uuw   5uuz   5uv5   5uvg   5uwx   5uwy   5ux9   5uxq   5uy9   5uzb   5uzs   5uzu   5v0g   5v0h   5v0j   5v0k   5v0s   5v1a   5v2i   5v38   5v3d   5v3n   5v4d   5v4f   5v4q   5v4u   5v52   5v5d   5v5e   5v5g   5v5h   5v5i   5v5z   5v68   5v69   5v6a   5v6s   5v6v   5v83   5v86   5v88   5v89   5v8f   5v8k   5v91   5v95   5v97   5v9f   5v9g   5v9h   5va6   5vab   5vac   5vah   5vb0   5vbc   5vbu   5vc0   5vcc   5vcd   5vce   5vcg   5vcn   5vco   5vf0   5vf4   5vfc   5vg6   5vgb   5vgr   5vgv   5vgx   5vh7   5vh8   5vh9   5vhw   5vi8   5vih   5vii   5vij   5viy   5vj7   5vj8   5vk5   5vkn   5vkp   5vkq   5vkw   5vl7   5vla   5vlh   5vlj   5vlk   5vll   5vlp   5vm5   5vn7   5vnu   5vo8   5voi   5voj   5vot   5vou   5vov   5vox   5voy   5vqq   5vqr   5vqs   5vqt   5vqu   5vqv   5vqw   5vqx   5vqy   5vqz   5vrt   5vst   5vsv   5vsw   5vtr   5vtu   5vtv   5vtw   5vtx   5vty   5vtz   5vu3   5vu4   5vug   5vuy   5vv0   5vv3   5vv5   5vvb   5vvc   5vvd   5vw1   5vwo   5vwq   5vwr   5vxb   5vxx   5vxy   5vyh   5vyq   5vyr   5vys   5vyt   5vyu   5vyv   5vz7   5vz8   5vz9   5vza   5vzb   5vzc   5vzr   5vzv   5vzw   5w0s   5w1r   5w1s   5w1t   5w2g   5w2h   5w2i   5w3f   5w3h   5w3j   5w46   5w54   5w59   5w5e   5w5f   5w5y   5w65   5w7i   5w7j   5w83   5w97   5wal   5wc0   5wc1   5wc6   5wcb   5wco   5wev   5wey   5wgr   5wgs   5wgt   5wgu   5wgv   5wgw   5wgx   5wgy   5wgz   5whw   5wjg   5wjh   5wk7   5wk9   5wol   5wwq   5wwr   5wws   5wwt   5x0z   5x22   5x93   5xf9   5xfa   5xl0   5xpr   5xqx   5xs2   5y0w   5y0y   5y10   5y11   6alf   6alg   6alh   6alx 

The complete details of the above PDB-ids are given below :

5GVZDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 1.75 Å
Title : SPACE GROUP C2221 AT RESOLUTION 1.75A.SPACE GROUP C2221 AT RESOLUTION 1.75A.
Classification : HYDROLASE
Molecule : PEPTIDYL-TRNA HYDROLASE;MOLECULE: PEPTIDYL-TRNA HYDROLASE;
5GWVDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.40 Å
Title : ANALOGUEANALOGUE
Classification : TRANSFERASE, DNA BINDING PROTEIN
Molecule : MOEN5,DNA-BINDING PROTEIN 7D;MOLECULE: MOEN5,DNA-BINDING PROTEIN 7D;
5GWWDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.30 Å
Title : PERMETHYLATED SUBSTRATE ANALOGUEPERMETHYLATED SUBSTRATE ANALOGUE
Classification : TRANSFERASE, DNA BINDING PROTEIN
Molecule : MOEN5,DNA-BINDING PROTEIN 7D;MOLECULE: MOEN5,DNA-BINDING PROTEIN 7D;
5GWYDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.85 Å
Title : WIDE SPECTRUM ANTI-CORONAVIRUS DRUG DESIGNWIDE SPECTRUM ANTI-CORONAVIRUS DRUG DESIGN
Classification : HYDROLASE/HYDROLASE INHIBITOR
Molecule : N-[(5-METHYLISOXAZOL-3-YL)CARBONYL]ALANYL-L-VALYL-N~1~-MOLECULE: N-[(5-METHYLISOXAZOL-3-YL)CARBONYL]ALANYL-L-VALYL-N~1~-
5GXDDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.00 Å
Title : 1212
Classification : LYASE
Molecule : AMP-DEPENDENT SYNTHETASE AND LIGASE;MOLECULE: AMP-DEPENDENT SYNTHETASE AND LIGASE;
5GXEDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 1.70 Å
Title : CRYSTAL STRUCTURE OF ACRYLOYL-COA REDUCTASE ACUI IN COMPLEX WITH NADPHRYSTAL STRUCTURE OF ACRYLOYL-COA REDUCTASE ACUI IN COMPLEX WITH NADPH
Classification : OXIDOREDUCTASE
Molecule : ACRYLYL-COA REDUCTASE ACUI;MOLECULE: ACRYLYL-COA REDUCTASE ACUI;
5GXFDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.29 Å
Title : ACRYLOYL-COA REDUCTASE ACUI FROM RUEGERIA POMEROYI DSS-3CRYLOYL-COA REDUCTASE ACUI FROM RUEGERIA POMEROYI DSS-3
Classification : OXIDOREDUCTASE
Molecule : ACRYLYL-COA REDUCTASE ACUI;MOLECULE: ACRYLYL-COA REDUCTASE ACUI;
5H5LDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.00 Å
Title : STRUCTURE OF PROSTAGLANDIN SYNTHASE D OF NILAPARVATA LUGENSTRUCTURE OF PROSTAGLANDIN SYNTHASE D OF NILAPARVATA LUGENS
Classification : TRANSFERASE
Molecule : GLUTATHIONE S-TRANSFERASE S2;MOLECULE: GLUTATHIONE S-TRANSFERASE S2;
5H6BDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.30 Å
Title : CRYSTAL STRUCTURE OF A THERMOSTABLE LIPASE FROM MARINE STREPTOMYCESRYSTAL STRUCTURE OF A THERMOSTABLE LIPASE FROM MARINE STREPTOMYCES
Classification : HYDROLASE
Molecule : PUTATIVE SECRETED LIPASE;MOLECULE: PUTATIVE SECRETED LIPASE;
5H6GDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.34 Å
Title : CRYSTAL STRUCTURE OF A THERMOSTABLE LIPASE FROM MARINE STREPTOMYCESRYSTAL STRUCTURE OF A THERMOSTABLE LIPASE FROM MARINE STREPTOMYCES
Classification : HYDROLASE
Molecule : PUTATIVE SECRETED LIPASE;MOLECULE: PUTATIVE SECRETED LIPASE;
5KNPDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.45 Å
Title : YL)PYRROLIDIN-3-YL)-OXYMETHANEPHOSPHONIC ACIDYL)PYRROLIDIN-3-YL)-OXYMETHANEPHOSPHONIC ACID
Classification : TRANSFERASE/INHIBITOR
Molecule : HYPOXANTHINE-GUANINE PHOSPHORIBOSYLTRANSFERASE;MOLECULE: HYPOXANTHINE-GUANINE PHOSPHORIBOSYLTRANSFERASE;
5KNQDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.55 Å
Title : PYRROLIDIN-3-YL)OXYMETHANEPHOSPHONIC ACID AND PYROPHOSPHATEPYRROLIDIN-3-YL)OXYMETHANEPHOSPHONIC ACID AND PYROPHOSPHATE
Classification : TRANSFERASE/INHIBITOR
Molecule : HYPOXANTHINE-GUANINE PHOSPHORIBOSYLTRANSFERASE;MOLECULE: HYPOXANTHINE-GUANINE PHOSPHORIBOSYLTRANSFERASE;
5KNYDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.91 Å
Title : PHOSPHONIC ACIDPHOSPHONIC ACID
Classification : TRANSFERASE/INHIBITOR
Molecule : HYPOXANTHINE-GUANINE PHOSPHORIBOSYLTRANSFERASE;MOLECULE: HYPOXANTHINE-GUANINE PHOSPHORIBOSYLTRANSFERASE;
5LSNDeposited : 20-SEP-17  (New)      Exp.Method :SOLUTION NMR
Title : UCHL1UCHL1
Classification : RNA
Molecule : RNA (29-MER);MOLECULE: RNA (29-MER);
5LT9Deposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 3.00 Å
Title : CHEMORECPETORS PCTB IN COMPLEX WITH L-ARGCHEMORECPETORS PCTB IN COMPLEX WITH L-ARG
Classification : SIGNALING PROTEIN
Molecule : METHYL-ACCEPTING CHEMOTAXIS PROTEIN PCTB;MOLECULE: METHYL-ACCEPTING CHEMOTAXIS PROTEIN PCTB;
5LTDDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.50 Å
Title : PHOSPHATE-BOUND PICHIA ANGUSTA ATG18HOSPHATE-BOUND PICHIA ANGUSTA ATG18
Classification : LIPID BINDING PROTEIN
Molecule : AUTOPHAGY-RELATED PROTEIN 18;MOLECULE: AUTOPHAGY-RELATED PROTEIN 18;
5LTGDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.00 Å
Title : CITRATE-BOUND PICHIA ANGUSTA ATG18ITRATE-BOUND PICHIA ANGUSTA ATG18
Classification : LIPID BINDING PROTEIN
Molecule : AUTOPHAGY-RELATED PROTEIN 18;MOLECULE: AUTOPHAGY-RELATED PROTEIN 18;
5LTMDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.41 Å
Title : VARIABILIS (Y78F-C503S-C565S) BOUND TO CINNAMATEVARIABILIS (Y78F-C503S-C565S) BOUND TO CINNAMATE
Classification : LYASE
Molecule : PHENYLALANINE AMMONIA LYASE;MOLECULE: PHENYLALANINE AMMONIA LYASE;
5LTODeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 3.46 Å
Title : CHEMORECPETORS PCTB IN COMPLEX WITH L-GLNCHEMORECPETORS PCTB IN COMPLEX WITH L-GLN
Classification : SIGNALING PROTEIN
Molecule : METHYL-ACCEPTING CHEMOTAXIS PROTEIN PCTB;MOLECULE: METHYL-ACCEPTING CHEMOTAXIS PROTEIN PCTB;
5LTUDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.23 Å
Title : PHOSPHOHYDROLASE 2PHOSPHOHYDROLASE 2
Classification : HYDROLASE
Molecule : DIPHOSPHOINOSITOL POLYPHOSPHATE PHOSPHOHYDROLASE 2;MOLECULE: DIPHOSPHOINOSITOL POLYPHOSPHATE PHOSPHOHYDROLASE 2;
5LTVDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.31 Å
Title : CHEMORECEPTORS PCTC IN COMPLEX WITH GABACHEMORECEPTORS PCTC IN COMPLEX WITH GABA
Classification : SIGNALING PROTEIN
Molecule : CHEMOTACTIC TRANSDUCER PCTC;MOLECULE: CHEMOTACTIC TRANSDUCER PCTC;
5LTXDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.02 Å
Title : CHEMORECEPTORS PCTA IN COMPLEX WITH L-METCHEMORECEPTORS PCTA IN COMPLEX WITH L-MET
Classification : SIGNALING PROTEIN
Molecule : CHEMOTAXIS PROTEIN;MOLECULE: CHEMOTAXIS PROTEIN;
5LU0Deposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 1.73 Å
Title : CRYSTAL STRUCTURE OF H. PYLORI REFERENT STRAIN IN COMPLEX WITH PO4RYSTAL STRUCTURE OF H. PYLORI REFERENT STRAIN IN COMPLEX WITH PO4
Classification : TRANSFERASE
Molecule : PURINE NUCLEOSIDE PHOSPHORYLASE DEOD-TYPE;MOLECULE: PURINE NUCLEOSIDE PHOSPHORYLASE DEOD-TYPE;
5LUCDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 1.80 Å
Title : ALDIMINE WITH PLP IN THE ACTIVE SITEALDIMINE WITH PLP IN THE ACTIVE SITE
Classification : TRANSFERASE
Molecule : SERINE--PYRUVATE AMINOTRANSFERASE;MOLECULE: SERINE--PYRUVATE AMINOTRANSFERASE;
5LUEDeposited : 20-SEP-17  (New)      Exp.Method :SOLUTION NMR
Title : MINOR FORM OF THE RECOMBINANT CYTOTOXIN-1 FROM N. OXIANAINOR FORM OF THE RECOMBINANT CYTOTOXIN-1 FROM N. OXIANA
Classification : TOXIN
Molecule : VC-1=CYTOTOXIN;MOLECULE: VC-1=CYTOTOXIN;
5LUGDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 1.70 Å
Title : ART(M3L)QTA(2MR)KS PEPTIDEART(M3L)QTA(2MR)KS PEPTIDE
Classification : CELL CYCLE
Molecule : ALA-ARG-THR-M3L-GLN-THR-ALA-2MR-LYS-SER;MOLECULE: ALA-ARG-THR-M3L-GLN-THR-ALA-2MR-LYS-SER;
5LURDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.70 Å
Title : AN AVIDIN MUTANTN AVIDIN MUTANT
Classification : BIOTIN BINDING PROTEIN
Molecule : AVIDIN;MOLECULE: AVIDIN;
5LV2Deposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.29 Å
Title : CRYSTAL STRUCTURE OF MOUSE CARM1 IN COMPLEX WITH INHIBITOR LH1246RYSTAL STRUCTURE OF MOUSE CARM1 IN COMPLEX WITH INHIBITOR LH1246
Classification : TRANSFERASE
Molecule : HISTONE-ARGININE METHYLTRANSFERASE CARM1;MOLECULE: HISTONE-ARGININE METHYLTRANSFERASE CARM1;
5LV3Deposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 1.80 Å
Title : CRYSTAL STRUCTURE OF MOUSE CARM1 IN COMPLEX WITH LIGAND LH1561BRRYSTAL STRUCTURE OF MOUSE CARM1 IN COMPLEX WITH LIGAND LH1561BR
Classification : TRANSFERASE
Molecule : HISTONE-ARGININE METHYLTRANSFERASE CARM1;MOLECULE: HISTONE-ARGININE METHYLTRANSFERASE CARM1;
5LV4Deposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 1.66 Å
Title : CRYSTAL STRUCTURE OF MOUSE PRMT6 IN COMPLEX WITH INHIBITOR LH1236RYSTAL STRUCTURE OF MOUSE PRMT6 IN COMPLEX WITH INHIBITOR LH1236
Classification : TRANSFERASE
Molecule : PROTEIN ARGININE N-METHYLTRANSFERASE 6;MOLECULE: PROTEIN ARGININE N-METHYLTRANSFERASE 6;
5LV5Deposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 1.80 Å
Title : CRYSTAL STRUCTURE OF MOUSE PRMT6 IN COMPLEX WITH INHIBITOR LH1458RYSTAL STRUCTURE OF MOUSE PRMT6 IN COMPLEX WITH INHIBITOR LH1458
Classification : TRANSFERASE
Molecule : PROTEIN ARGININE N-METHYLTRANSFERASE 6;MOLECULE: PROTEIN ARGININE N-METHYLTRANSFERASE 6;
5LXSDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.20 Å
Title : TUBULIN-KS-1-199-32 COMPLEXUBULIN-KS-1-199-32 COMPLEX
Classification : CELL CYCLE
Molecule : TUBULIN TYROSINE LIGASE;MOLECULE: TUBULIN TYROSINE LIGASE;
5LY9Deposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 1.65 Å
Title : STRUCTURE OF MITAT 1.1TRUCTURE OF MITAT 1.1
Classification : IMMUNE SYSTEM
Molecule : VARIANT SURFACE GLYCOPROTEIN MITAT 1.1;MOLECULE: VARIANT SURFACE GLYCOPROTEIN MITAT 1.1;
5M24Deposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 1.69 Å
Title : RARG MUTANT-S371EARG MUTANT-S371E
Classification : NUCLEAR RECEPTOR
Molecule : RETINOIC ACID RECEPTOR GAMMA;MOLECULE: RETINOIC ACID RECEPTOR GAMMA;
5M4TDeposited : 20-SEP-17  (New)      Exp.Method :SOLUTION NMR
Title : C-TERMINAL DOMAIN STRUCTURE OF VSG M1.1-TERMINAL DOMAIN STRUCTURE OF VSG M1.1
Classification : MEMBRANE PROTEIN
Molecule : VARIANT SURFACE GLYCOPROTEIN MITAT 1.1;MOLECULE: VARIANT SURFACE GLYCOPROTEIN MITAT 1.1;
5MCBDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 1.95 Å
Title : GLYCOGEN PHOSPHORYLASE IN COMPLEX WITH CHLOROGENIC ACID.LYCOGEN PHOSPHORYLASE IN COMPLEX WITH CHLOROGENIC ACID.
Classification : TRANSFERASE
Molecule : GLYCOGEN PHOSPHORYLASE, MUSCLE FORM;MOLECULE: GLYCOGEN PHOSPHORYLASE, MUSCLE FORM;
5MF2Deposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.00 Å
Title : BACTERIOPHAGE T5 DISTAL TAIL PROTEIN PB9 CO-CRYSTALLIZED WITH TB-XO4ACTERIOPHAGE T5 DISTAL TAIL PROTEIN PB9 CO-CRYSTALLIZED WITH TB-XO4
Classification : VIRAL PROTEIN
Molecule : DISTAL TAIL PROTEIN;MOLECULE: DISTAL TAIL PROTEIN;
5MF4Deposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.30 Å
Title : TUBULIN-DICTYOSTATIN COMPLEXUBULIN-DICTYOSTATIN COMPLEX
Classification : CELL CYCLE
Molecule : UNCHARACTERIZED PROTEIN;MOLECULE: UNCHARACTERIZED PROTEIN;
5MTCDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 1.70 Å
Title : BACTERIOPHAGE VP16T - CRYSTAL FORM IBACTERIOPHAGE VP16T - CRYSTAL FORM I
Classification : HYDROLASE
Molecule : PUTATIVE UNCHARACTERIZED PROTEIN ORF60T;MOLECULE: PUTATIVE UNCHARACTERIZED PROTEIN ORF60T;
5MTDDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 1.50 Å
Title : BACTERIOPHAGE VP16T - CRYSTAL FORM IIBACTERIOPHAGE VP16T - CRYSTAL FORM II
Classification : HYDROLASE
Molecule : PUTATIVE UNCHARACTERIZED PROTEIN ORF60T;MOLECULE: PUTATIVE UNCHARACTERIZED PROTEIN ORF60T;
5MVRDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 1.76 Å
Title : CRYSTAL STRUCTURE OF BACILLUS SUBTILUS YDIBRYSTAL STRUCTURE OF BACILLUS SUBTILUS YDIB
Classification : TRANSFERASE
Molecule : TRNA THREONYLCARBAMOYLADENOSINE BIOSYNTHESIS PROTEIN TSAE;MOLECULE: TRNA THREONYLCARBAMOYLADENOSINE BIOSYNTHESIS PROTEIN TSAE;
5N5DDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 1.55 Å
Title : ACHROMOGENES INVOLVED IN TOMAYMYCIN SYNTHESIS IN COMPLEX WITH SAMACHROMOGENES INVOLVED IN TOMAYMYCIN SYNTHESIS IN COMPLEX WITH SAM
Classification : TRANSFERASE
Molecule : METHYLTRANSFERASE;MOLECULE: METHYLTRANSFERASE;
5N63Deposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.40 Å
Title : CRYSTAL STRUCTURE OF P38ALPHA IN COMPLEX WITH LIPID POCKET LIGAND 9CRYSTAL STRUCTURE OF P38ALPHA IN COMPLEX WITH LIPID POCKET LIGAND 9C
Classification : TRANSFERASE
Molecule : MITOGEN-ACTIVATED PROTEIN KINASE 14;MOLECULE: MITOGEN-ACTIVATED PROTEIN KINASE 14;
5N64Deposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.40 Å
Title : CRYSTAL STRUCTURE OF P38ALPHA IN COMPLEX WITH LIPID POCKET LIGAND 9GRYSTAL STRUCTURE OF P38ALPHA IN COMPLEX WITH LIPID POCKET LIGAND 9G
Classification : TRANSFERASE
Molecule : MITOGEN-ACTIVATED PROTEIN KINASE 14;MOLECULE: MITOGEN-ACTIVATED PROTEIN KINASE 14;
5N65Deposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.00 Å
Title : CRYSTAL STRUCTURE OF P38ALPHA IN COMPLEX WITH LIPID POCKET LIGAND 9HRYSTAL STRUCTURE OF P38ALPHA IN COMPLEX WITH LIPID POCKET LIGAND 9H
Classification : TRANSFERASE
Molecule : MITOGEN-ACTIVATED PROTEIN KINASE 14;MOLECULE: MITOGEN-ACTIVATED PROTEIN KINASE 14;
5N66Deposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.40 Å
Title : CRYSTAL STRUCTURE OF P38ALPHA IN COMPLEX WITH LIPID POCKET LIGAND 9JRYSTAL STRUCTURE OF P38ALPHA IN COMPLEX WITH LIPID POCKET LIGAND 9J
Classification : TRANSFERASE
Molecule : MITOGEN-ACTIVATED PROTEIN KINASE 14;MOLECULE: MITOGEN-ACTIVATED PROTEIN KINASE 14;
5N67Deposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 1.90 Å
Title : CRYSTAL STRUCTURE OF P38ALPHA IN COMPLEX WITH LIPID POCKET LIGAND 9LRYSTAL STRUCTURE OF P38ALPHA IN COMPLEX WITH LIPID POCKET LIGAND 9L
Classification : TRANSFERASE
Molecule : MITOGEN-ACTIVATED PROTEIN KINASE 14;MOLECULE: MITOGEN-ACTIVATED PROTEIN KINASE 14;
5N68Deposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 1.85 Å
Title : CRYSTAL STRUCTURE OF P38ALPHA IN COMPLEX WITH LIPID POCKET LIGAND 9MRYSTAL STRUCTURE OF P38ALPHA IN COMPLEX WITH LIPID POCKET LIGAND 9M
Classification : TRANSFERASE
Molecule : MITOGEN-ACTIVATED PROTEIN KINASE 14;MOLECULE: MITOGEN-ACTIVATED PROTEIN KINASE 14;
5NH1Deposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.04 Å
Title : STRUCTURE OF THE C-TERMINAL DOMAIN OF HUMAN GASDERMIN DTRUCTURE OF THE C-TERMINAL DOMAIN OF HUMAN GASDERMIN D
Classification : IMMUNE SYSTEM
Molecule : GASDERMIN-D;MOLECULE: GASDERMIN-D;
5NR5Deposited : 20-SEP-17  (New)      Exp.Method :SOLUTION NMR
Title : DISCOIDEUM MATA PROTEINDISCOIDEUM MATA PROTEIN
Classification : DNA BINDING PROTEIN
Molecule : MATA PROTEIN;MOLECULE: MATA PROTEIN;
5NR6Deposited : 20-SEP-17  (New)      Exp.Method :SOLUTION NMR
Title : DISCOIDANS MATB PROTEIN S71A MUTANTDISCOIDANS MATB PROTEIN S71A MUTANT
Classification : DNA BINDING PROTEIN
Molecule : MATB PROTEIN;MOLECULE: MATB PROTEIN;
5NSWDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.50 Å
Title : XENON FOR TUNNELLING ANALYSIS OF THE EFFLUX PUMP COMPONENT OPRN.ENON FOR TUNNELLING ANALYSIS OF THE EFFLUX PUMP COMPONENT OPRN.
Classification : MEMBRANE PROTEIN
Molecule : MULTIDRUG EFFLUX OUTER MEMBRANE PROTEIN OPRN;MOLECULE: MULTIDRUG EFFLUX OUTER MEMBRANE PROTEIN OPRN;
5NT5Deposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.30 Å
Title : D(CGTGAATTCACG)D(CGTGAATTCACG)
Classification : DNA
Molecule : DNA (5'-D(*CP*GP*TP*GP*AP*AP*TP*TP*CP*AP*CP*G)-3');MOLECULE: DNA (5'-D(*CP*GP*TP*GP*AP*AP*TP*TP*CP*AP*CP*G)-3');
5NVVDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.10 Å
Title : BENZYL)PYRROLIDINE-2-CARBOXAMIDE (LIGAND 3)BENZYL)PYRROLIDINE-2-CARBOXAMIDE (LIGAND 3)
Classification : LIGASE
Molecule : VON HIPPEL-LINDAU DISEASE TUMOR SUPPRESSOR;MOLECULE: VON HIPPEL-LINDAU DISEASE TUMOR SUPPRESSOR;
5NVWDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.20 Å
Title : METHYLTHIAZOL-5-YL)BENZYL)PYRROLIDINE-2-CARBOXAMIDE (LIGAND 6)METHYLTHIAZOL-5-YL)BENZYL)PYRROLIDINE-2-CARBOXAMIDE (LIGAND 6)
Classification : LIGASE
Molecule : VON HIPPEL-LINDAU DISEASE TUMOR SUPPRESSOR;MOLECULE: VON HIPPEL-LINDAU DISEASE TUMOR SUPPRESSOR;
5NVXDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.20 Å
Title : (4-METHYLTHIAZOL-5-YL)BENZYL)PYRROLIDINE-2-CARBOXAMIDE (LIGAND 10)(4-METHYLTHIAZOL-5-YL)BENZYL)PYRROLIDINE-2-CARBOXAMIDE (LIGAND 10)
Classification : LIGASE
Molecule : VON HIPPEL-LINDAU DISEASE TUMOR SUPPRESSOR;MOLECULE: VON HIPPEL-LINDAU DISEASE TUMOR SUPPRESSOR;
5NVYDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.90 Å
Title : (LIGAND 11)(LIGAND 11)
Classification : LIGASE
Molecule : VON HIPPEL-LINDAU DISEASE TUMOR SUPPRESSOR;MOLECULE: VON HIPPEL-LINDAU DISEASE TUMOR SUPPRESSOR;
5NVZDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.70 Å
Title : (4-METHYLTHIAZOL-5-YL)BENZYL)PYRROLIDINE-2-CARBOXAMIDE (LIGAND 16)(4-METHYLTHIAZOL-5-YL)BENZYL)PYRROLIDINE-2-CARBOXAMIDE (LIGAND 16)
Classification : LIGASE
Molecule : VON HIPPEL-LINDAU DISEASE TUMOR SUPPRESSOR;MOLECULE: VON HIPPEL-LINDAU DISEASE TUMOR SUPPRESSOR;
5NW0Deposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.30 Å
Title : (4-(4-METHYLTHIAZOL-5-YL)BENZYL)PYRROLIDINE-2-CARBOXAMIDE (LIGAND 17)(4-(4-METHYLTHIAZOL-5-YL)BENZYL)PYRROLIDINE-2-CARBOXAMIDE (LIGAND 17)
Classification : LIGASE
Molecule : VON HIPPEL-LINDAU DISEASE TUMOR SUPPRESSOR;MOLECULE: VON HIPPEL-LINDAU DISEASE TUMOR SUPPRESSOR;
5NW1Deposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.10 Å
Title : METHYLTHIAZOL-5-YL)BENZYL)PYRROLIDINE-2-CARBOXAMIDE (LIGAND 18)METHYLTHIAZOL-5-YL)BENZYL)PYRROLIDINE-2-CARBOXAMIDE (LIGAND 18)
Classification : LIGASE
Molecule : VON HIPPEL-LINDAU DISEASE TUMOR SUPPRESSOR;MOLECULE: VON HIPPEL-LINDAU DISEASE TUMOR SUPPRESSOR;
5NW2Deposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.20 Å
Title : PYRROLIDINE-2-CARBOXAMIDE (LIGAND 19)PYRROLIDINE-2-CARBOXAMIDE (LIGAND 19)
Classification : LIGASE
Molecule : VON HIPPEL-LINDAU DISEASE TUMOR SUPPRESSOR;MOLECULE: VON HIPPEL-LINDAU DISEASE TUMOR SUPPRESSOR;
5NX4Deposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.38 Å
Title : CLAVULIGERUSCLAVULIGERUS
Classification : LIGASE
Molecule : PENTALENENE SYNTHASE;MOLECULE: PENTALENENE SYNTHASE;
5NX5Deposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 1.82 Å
Title : CLAVULIGERUS IN COMPLEX WITH 2-FLUOROGERANYL DIPHOSPHATECLAVULIGERUS IN COMPLEX WITH 2-FLUOROGERANYL DIPHOSPHATE
Classification : LIGASE
Molecule : PENTALENENE SYNTHASE;MOLECULE: PENTALENENE SYNTHASE;
5NX6Deposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 1.63 Å
Title : CLAVULIGERUS IN COMPLEX WITH 2-FLUORONERYL DIPHOSPHATECLAVULIGERUS IN COMPLEX WITH 2-FLUORONERYL DIPHOSPHATE
Classification : LYASE
Molecule : PENTALENENE SYNTHASE;MOLECULE: PENTALENENE SYNTHASE;
5NX7Deposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 1.51 Å
Title : FLUOROGERANYL DIPHOSPHATEFLUOROGERANYL DIPHOSPHATE
Classification : LYASE
Molecule : PENTALENENE SYNTHASE;MOLECULE: PENTALENENE SYNTHASE;
5NYZDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.50 Å
Title : FROM DUTPASE 80ALPHA PHAGE.FROM DUTPASE 80ALPHA PHAGE.
Classification : HYDROLASE
Molecule : DUTPASE;MOLECULE: DUTPASE;
5NZ2Deposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.85 Å
Title : FROM DUTPASE 80ALPHA PHAGE.FROM DUTPASE 80ALPHA PHAGE.
Classification : HYDROLASE
Molecule : DUTPASE;MOLECULE: DUTPASE;
5O1QDeposited : 20-SEP-17  (New)      Exp.Method :SOLUTION NMR
Title : LYSF1 SH3B DOMAIN STRUCTUREYSF1 SH3B DOMAIN STRUCTURE
Classification : HYDROLASE
Molecule : SH3B DOMAIN;MOLECULE: SH3B DOMAIN;
5O2MDeposited : 20-SEP-17  (New)      Exp.Method :SOLUTION NMR
Title : P130CAS SH3 DOMAIN130CAS SH3 DOMAIN
Classification : STRUCTURE FROM CYANA 3.97
Molecule : BREAST CANCER ANTI-ESTROGEN RESISTANCE 1;MOLECULE: BREAST CANCER ANTI-ESTROGEN RESISTANCE 1;
5O2PDeposited : 20-SEP-17  (New)      Exp.Method :SOLUTION NMR
Title : P130CAS SH3 DOMAIN PTP-PEST PEPTIDE CHIMERA130CAS SH3 DOMAIN PTP-PEST PEPTIDE CHIMERA
Classification : STRUCTURE FROM CYANA 3.97
Molecule : BREAST CANCER ANTI-ESTROGEN RESISTANCE 1,TYROSINE-PROTEINMOLECULE: BREAST CANCER ANTI-ESTROGEN RESISTANCE 1,TYROSINE-PROTEIN
5O2QDeposited : 20-SEP-17  (New)      Exp.Method :SOLUTION NMR
Title : P130CAS SH3 DOMAIN VINCULIN PEPTIDE CHIMERA130CAS SH3 DOMAIN VINCULIN PEPTIDE CHIMERA
Classification : STRUCTURE FROM CYANA 3.97
Molecule : BREAST CANCER ANTI-ESTROGEN RESISTANCE 1,VINCULIN;MOLECULE: BREAST CANCER ANTI-ESTROGEN RESISTANCE 1,VINCULIN;
5O2WDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.00 Å
Title : EXTENDED CATALYTIC DOMAIN OF HYPOCREA JECORINA LPMO 9A.XTENDED CATALYTIC DOMAIN OF HYPOCREA JECORINA LPMO 9A.
Classification : OXIDOREDUCTASE
Molecule : GLYCOSIDE HYDROLASE FAMILY 61;MOLECULE: GLYCOSIDE HYDROLASE FAMILY 61;
5O2XDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 0.95 Å
Title : EXTENDED CATALYTIC DOMAIN OF H. JECORINA LPMO9A A.K.A EG4XTENDED CATALYTIC DOMAIN OF H. JECORINA LPMO9A A.K.A EG4
Classification : OXIDOREDUCTASE
Molecule : GLYCOSIDE HYDROLASE FAMILY 61;MOLECULE: GLYCOSIDE HYDROLASE FAMILY 61;
5O45Deposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 0.99 Å
Title : STRUCTURE OF HUMAN PD-L1 IN COMPLEX WITH INHIBITORTRUCTURE OF HUMAN PD-L1 IN COMPLEX WITH INHIBITOR
Classification : CELL CYCLE
Molecule : PHE-MEA-9KK-SAR-ASP-VAL-MEA-TYR-SAR-TRP-TYR-LEU-CCS-GLY-MOLECULE: PHE-MEA-9KK-SAR-ASP-VAL-MEA-TYR-SAR-TRP-TYR-LEU-CCS-GLY-
5O4YDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.30 Å
Title : STRUCTURE OF HUMAN PD-L1 IN COMPLEX WITH INHIBITORTRUCTURE OF HUMAN PD-L1 IN COMPLEX WITH INHIBITOR
Classification : CELL CYCLE
Molecule : PHE-MAA-ASN-PRO-HIS-LEU-SER-TRP-SER-TRP-9KK-9KK-ARG-CCS-MOLECULE: PHE-MAA-ASN-PRO-HIS-LEU-SER-TRP-SER-TRP-9KK-9KK-ARG-CCS-
5O83Deposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.90 Å
Title : CLASS OF PI3K DELTA-SELECTIVE INHIBITORSCLASS OF PI3K DELTA-SELECTIVE INHIBITORS
Classification : TRANSFERASE
Molecule : PHOSPHATIDYLINOSITOL 4,5-BISPHOSPHATE 3-KINASE CATALYTICMOLECULE: PHOSPHATIDYLINOSITOL 4,5-BISPHOSPHATE 3-KINASE CATALYTIC
5OCADeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.30 Å
Title : PCSK9:FAB COMPLEX WITH DEXTRAN SULFATECSK9:FAB COMPLEX WITH DEXTRAN SULFATE
Classification : HYDROLASE
Molecule : FAB FROM LDLR COMPETITIVE ANTIBODY: LIGHT CHAIN;MOLECULE: FAB FROM LDLR COMPETITIVE ANTIBODY: LIGHT CHAIN;
5OEYDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.80 Å
Title : HOLO FORM.HOLO FORM.
Classification : HYDROLASE
Molecule : FBP PROTEIN;MOLECULE: FBP PROTEIN;
5OEZDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.41 Å
Title : APO FORM.APO FORM.
Classification : HYDROLASE
Molecule : FBP PROTEIN;MOLECULE: FBP PROTEIN;
5OFUDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.62 Å
Title : T-STATE.T-STATE.
Classification : TRANSFERASE
Molecule : FBP PROTEIN;MOLECULE: FBP PROTEIN;
5OHKDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.34 Å
Title : PROPARGYLAMIDE (HIGH RESOLUTION)PROPARGYLAMIDE (HIGH RESOLUTION)
Classification : HYDROLASE
Molecule : POLYUBIQUITIN-B;MOLECULE: POLYUBIQUITIN-B;
5OHNDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 3.60 Å
Title : PROPARGYLAMIDE (LOW RESOLUTION)PROPARGYLAMIDE (LOW RESOLUTION)
Classification : HYDROLASE
Molecule : POLYUBIQUITIN-B;MOLECULE: POLYUBIQUITIN-B;
5OHPDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.80 Å
Title : DIUBIQUITINDIUBIQUITIN
Classification : HYDROLASE
Molecule : POLYUBIQUITIN-B;MOLECULE: POLYUBIQUITIN-B;
5OOQDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 3.20 Å
Title : STRUCTURE OF THE MTR4 NOP53 COMPLEXTRUCTURE OF THE MTR4 NOP53 COMPLEX
Classification : RNA BINDING PROTEIN
Molecule : RIBOSOME BIOGENESIS PROTEIN NOP53;MOLECULE: RIBOSOME BIOGENESIS PROTEIN NOP53;
5OWXDeposited : 20-SEP-17  (New)      Exp.Method :ELECTRON MICROSCOPY with the resolution of 5.20 Å
Title : INSIDE-OUT FMDV A10 CAPSIDNSIDE-OUT FMDV A10 CAPSID
Classification : VIRUS LIKE PARTICLE
Molecule : GENOME POLYPROTEIN;MOLECULE: GENOME POLYPROTEIN;
5OXGDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.13 Å
Title : 212854212854
Classification : SIGNALING PROTEIN
Molecule : ACTIVIN RECEPTOR TYPE-1;MOLECULE: ACTIVIN RECEPTOR TYPE-1;
5OY3Deposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.14 Å
Title : 27 SPECIFICITY27 SPECIFICITY
Classification : OXIDOREDUCTASE
Molecule : HISTONE 3 PEPTIDE H3(17-33)A21M;MOLECULE: HISTONE 3 PEPTIDE H3(17-33)A21M;
5OY7Deposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 5.77 Å
Title : STRUCTURE OF THE 4_601_157 TETRANUCLEOSOME (P1 FORM)TRUCTURE OF THE 4_601_157 TETRANUCLEOSOME (P1 FORM)
Classification : GENE REGULATION
Molecule : DNA (619-MER);MOLECULE: DNA (619-MER);
5OYIDeposited : 20-SEP-17  (New)      Exp.Method :ELECTRON MICROSCOPY with the resolution of 8.20 Å
Title : FMDV A10 DISSOCIATED PENTAMERMDV A10 DISSOCIATED PENTAMER
Classification : VIRAL PROTEIN
Molecule : GENOME POLYPROTEIN;MOLECULE: GENOME POLYPROTEIN;
5T7MDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.25 Å
Title : CHEMORECEPTORS PCTA IN COMPLEX WITH L-TRPCHEMORECEPTORS PCTA IN COMPLEX WITH L-TRP
Classification : SIGNALING PROTEIN
Molecule : CHEMOTAXIS PROTEIN;MOLECULE: CHEMOTAXIS PROTEIN;
5T7ODeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 1.80 Å
Title : THYMIDYLATE SYNTHASE IN COMPLEX WITH (6S)-5,6,7,8-TETRAHYDROFOLATETHYMIDYLATE SYNTHASE IN COMPLEX WITH (6S)-5,6,7,8-TETRAHYDROFOLATE
Classification : OXIDOREDUCTASE
Molecule : BIFUNCTIONAL DIHYDROFOLATE REDUCTASE-THYMIDYLATE SYNTHASE;MOLECULE: BIFUNCTIONAL DIHYDROFOLATE REDUCTASE-THYMIDYLATE SYNTHASE;
5T84Deposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 1.65 Å
Title : HIV-1 PROTEASE, UNBOUND SUBTYPE B L63P CONSTRUCTIV-1 PROTEASE, UNBOUND SUBTYPE B L63P CONSTRUCT
Classification : HYDROLASE
Molecule : PROTEASE;MOLECULE: PROTEASE;
5T8ADeposited : 20-SEP-17  (New)      Exp.Method :SOLUTION NMR
Title : RECOMBINANT CYTOTOXIN-I FROM THE VENOM OF COBRA N. OXIANAECOMBINANT CYTOTOXIN-I FROM THE VENOM OF COBRA N. OXIANA
Classification : TOXIN
Molecule : CYTOTOXIN 1;MOLECULE: CYTOTOXIN 1;
5TBHDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.34 Å
Title : CRYSTAL STRUCTURE OF MOUSE CARM1 IN COMPLEX WITH INHIBITOR LH1236RYSTAL STRUCTURE OF MOUSE CARM1 IN COMPLEX WITH INHIBITOR LH1236
Classification : TRANSFERASE
Molecule : HISTONE-ARGININE METHYLTRANSFERASE CARM1;MOLECULE: HISTONE-ARGININE METHYLTRANSFERASE CARM1;
5TBIDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.29 Å
Title : CRYSTAL STRUCTURE OF MOUSE CARM1 IN COMPLEX WITH INHIBITOR LH1427RYSTAL STRUCTURE OF MOUSE CARM1 IN COMPLEX WITH INHIBITOR LH1427
Classification : TRANSFERASE
Molecule : HISTONE-ARGININE METHYLTRANSFERASE CARM1;MOLECULE: HISTONE-ARGININE METHYLTRANSFERASE CARM1;
5TBJDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.32 Å
Title : CRYSTAL STRUCTURE OF MOUSE CARM1 IN COMPLEX WITH INHIBITOR LH1452RYSTAL STRUCTURE OF MOUSE CARM1 IN COMPLEX WITH INHIBITOR LH1452
Classification : TRANSFERASE
Molecule : HISTONE-ARGININE METHYLTRANSFERASE CARM1;MOLECULE: HISTONE-ARGININE METHYLTRANSFERASE CARM1;
5TCBDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 1.54 Å
Title : AERUGINOSAAERUGINOSA
Classification : HYDROLASE
Molecule : PELA;MOLECULE: PELA;
5TCEDeposited : 20-SEP-17  (New)      Exp.Method :SOLUTION NMR
Title : N-TERMINAL MICRODOMAIN OF 34-MERS FROM HSDHODH - N-T(DH)-TERMINAL MICRODOMAIN OF 34-MERS FROM HSDHODH - N-T(DH)
Classification : OXIDOREDUCTASE
Molecule : DIHYDROOROTATE DEHYDROGENASE (QUINONE), MITOCHONDRIAL;MOLECULE: DIHYDROOROTATE DEHYDROGENASE (QUINONE), MITOCHONDRIAL;
5TCLDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 3.20 Å
Title : THAUMATIN FROM 4.96 A WAVELENGTH DATA COLLECTIONHAUMATIN FROM 4.96 A WAVELENGTH DATA COLLECTION
Classification : PLANT PROTEIN
Molecule : THAUMATIN-1;MOLECULE: THAUMATIN-1;
5TCVDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.60 Å
Title : ACIDACID
Classification : OXIDOREDUCTASE
Molecule : 1-AMINOCYCLOPROPANE-1-CARBOXYLATE OXIDASE 1;MOLECULE: 1-AMINOCYCLOPROPANE-1-CARBOXYLATE OXIDASE 1;
5TCWDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.70 Å
Title : ACC OXIDASE COMPLEX WITH NICKEL AND ACETATECC OXIDASE COMPLEX WITH NICKEL AND ACETATE
Classification : OXIDOREDUCTASE
Molecule : 1-AMINOCYCLOPROPANE-1-CARBOXYLATE OXIDASE 1;MOLECULE: 1-AMINOCYCLOPROPANE-1-CARBOXYLATE OXIDASE 1;
5TD6Deposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.03 Å
Title : C. ELEGANS FOG-3 BTG/TOB DOMAIN - H47N, C117A. ELEGANS FOG-3 BTG/TOB DOMAIN - H47N, C117A
Classification : RNA BINDING PROTEIN
Molecule : FOG-3 PROTEIN;MOLECULE: FOG-3 PROTEIN;
5TSADeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.40 Å
Title : BRONCHISEPTICA WITH BOUND ZN2+BRONCHISEPTICA WITH BOUND ZN2+
Classification : METAL BINDING PROTEIN
Molecule : MEMBRANE PROTEIN;MOLECULE: MEMBRANE PROTEIN;
5TSBDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.70 Å
Title : BRONCHISEPTICA WITH BOUND CD2+BRONCHISEPTICA WITH BOUND CD2+
Classification : METAL BINDING PROTEIN
Molecule : MEMBRANE PROTEIN;MOLECULE: MEMBRANE PROTEIN;
5TTPDeposited : 20-SEP-17  (New)      Exp.Method :ELECTRON MICROSCOPY with the resolution of 4.80 Å
Title : CRYO-EM STRUCTURE OF MSBA-NANODISC WITH ADP-VANADATERYO-EM STRUCTURE OF MSBA-NANODISC WITH ADP-VANADATE
Classification : HYDROLASE
Molecule : LIPID A EXPORT ATP-BINDING/PERMEASE PROTEIN MSBA;MOLECULE: LIPID A EXPORT ATP-BINDING/PERMEASE PROTEIN MSBA;
5TV3Deposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.90 Å
Title : METHYL-4,5-DIHYDRO-1,3,4-THIADIAZOLE-2-SULFONAMIDEMETHYL-4,5-DIHYDRO-1,3,4-THIADIAZOLE-2-SULFONAMIDE
Classification : LYASE/LYASE INHIBITOR
Molecule : ALPHA-CARBONIC ANHYDRASE;MOLECULE: ALPHA-CARBONIC ANHYDRASE;
5TV4Deposited : 20-SEP-17  (New)      Exp.Method :ELECTRON MICROSCOPY with the resolution of 4.20 Å
Title : 3D CRYO-EM RECONSTRUCTION OF NUCLEOTIDE-FREE MSBA IN LIPID NANODISCD CRYO-EM RECONSTRUCTION OF NUCLEOTIDE-FREE MSBA IN LIPID NANODISC
Classification : HYDROLASE
Molecule : LIPID A EXPORT ATP-BINDING/PERMEASE PROTEIN MSBA;MOLECULE: LIPID A EXPORT ATP-BINDING/PERMEASE PROTEIN MSBA;
5TVBDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.75 Å
Title : STRUCTURE OF THE TPR OLIGOMERIZATION DOMAINTRUCTURE OF THE TPR OLIGOMERIZATION DOMAIN
Classification : TRANSFERASE
Molecule : NUCLEOPROTEIN TPR;MOLECULE: NUCLEOPROTEIN TPR;
5TW2Deposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 1.75 Å
Title : STRUCTURE OF MOUSE CD1D WITH BOUND ALPHA-GALACTOSYLSPHINGAMIDE JG168TRUCTURE OF MOUSE CD1D WITH BOUND ALPHA-GALACTOSYLSPHINGAMIDE JG168
Classification : IMMUNE SYSTEM/INHIBITOR
Molecule : BETA-2-MICROGLOBULIN;MOLECULE: BETA-2-MICROGLOBULIN;
5TW5Deposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 1.85 Å
Title : STRUCTURE OF MOUSE CD1D WITH BOUND GLYCOSPHINGOLIPID JJ112TRUCTURE OF MOUSE CD1D WITH BOUND GLYCOSPHINGOLIPID JJ112
Classification : IMMUNE SYSTEM/INHIBITOR
Molecule : BETA-2-MICROGLOBULIN;MOLECULE: BETA-2-MICROGLOBULIN;
5U4UDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 1.90 Å
Title : PSEUDOGTPASE DOMAIN (PG1) OF P190RHOGAP-ASEUDOGTPASE DOMAIN (PG1) OF P190RHOGAP-A
Classification : HYDROLASE
Molecule : MGC81300 PROTEIN;MOLECULE: MGC81300 PROTEIN;
5U4VDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.60 Å
Title : PSEUDOGTPASE DOMAIN (PG1) OF P190RHOGAP-BSEUDOGTPASE DOMAIN (PG1) OF P190RHOGAP-B
Classification : HYDROLASE
Molecule : RHO GTPASE-ACTIVATING PROTEIN 5;MOLECULE: RHO GTPASE-ACTIVATING PROTEIN 5;
5U64Deposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 1.15 Å
Title : CAMEL NANOBODY VHH-28AMEL NANOBODY VHH-28
Classification : IMMUNE SYSTEM
Molecule : VHH-28;MOLECULE: VHH-28;
5U65Deposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.30 Å
Title : CAMEL NANOBODY VHH-5AMEL NANOBODY VHH-5
Classification : IMMUNE SYSTEM
Molecule : VHH-5;MOLECULE: VHH-5;
5U99Deposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.40 Å
Title : PHOSPHORIBOSYLTRANSFERASEPHOSPHORIBOSYLTRANSFERASE
Classification : TRANSFERASE
Molecule : ATP PHOSPHORIBOSYLTRANSFERASE;MOLECULE: ATP PHOSPHORIBOSYLTRANSFERASE;
5UBXDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.70 Å
Title : PROTEIN A PEPTIDE ANALOG Z34CPROTEIN A PEPTIDE ANALOG Z34C
Classification : IMMUNE SYSTEM
Molecule : PEPTIDE ANALOG OF B-DOMAIN FROM PROTEIN A - Z34C;MOLECULE: PEPTIDE ANALOG OF B-DOMAIN FROM PROTEIN A - Z34C;
5UGZDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 1.98 Å
Title : CRYSTAL STRUCTURE OF CLBQ FROM THE COLIBACTIN NRPS/PKS PATHWAYRYSTAL STRUCTURE OF CLBQ FROM THE COLIBACTIN NRPS/PKS PATHWAY
Classification : HYDROLASE
Molecule : PUTATIVE THIOESTERASE;MOLECULE: PUTATIVE THIOESTERASE;
5USHDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.30 Å
Title : STRUCTURE OF VACCINIA VIRUS D8 PROTEIN BOUND TO HUMAN FAB VV66TRUCTURE OF VACCINIA VIRUS D8 PROTEIN BOUND TO HUMAN FAB VV66
Classification : VIRAL PROTEIN/IMMUNE SYSTEM
Molecule : FAB VV66 LIGHT CHAIN;MOLECULE: FAB VV66 LIGHT CHAIN;
5USIDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.90 Å
Title : STRUCTURE OF VACCINIA VIRUS D8 PROTEIN BOUND TO HUMAN FAB VV138TRUCTURE OF VACCINIA VIRUS D8 PROTEIN BOUND TO HUMAN FAB VV138
Classification : VIRAL PROTEIN/IMMUNE SYSTEM
Molecule : FAB VV138 LIGHT CHAIN;MOLECULE: FAB VV138 LIGHT CHAIN;
5USLDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.90 Å
Title : STRUCTURE OF VACCINIA VIRUS D8 PROTEIN BOUND TO HUMAN FAB VV304TRUCTURE OF VACCINIA VIRUS D8 PROTEIN BOUND TO HUMAN FAB VV304
Classification : VIRAL PROTEIN/IMMUNE SYSTEM
Molecule : FAB VV304 LIGHT CHAIN;MOLECULE: FAB VV304 LIGHT CHAIN;
5V4BDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.60 Å
Title : CRYSTAL STRUCTURE OF THE SKP1-FBXW7-DISC1 COMPLEXRYSTAL STRUCTURE OF THE SKP1-FBXW7-DISC1 COMPLEX
Classification : TRANSCRIPTION
Molecule : DISC1 PEPTIDE;MOLECULE: DISC1 PEPTIDE;
5V7QDeposited : 20-SEP-17  (New)      Exp.Method :ELECTRON MICROSCOPY with the resolution of 3.70 Å
Title : TUBERCULOSIS BOUND WITH A POTENT LINEZOLID ANALOGTUBERCULOSIS BOUND WITH A POTENT LINEZOLID ANALOG
Classification : RIBOSOME
Molecule : 50S RIBOSOMAL PROTEIN L30;MOLECULE: 50S RIBOSOMAL PROTEIN L30;
5VEMDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.60 Å
Title : NPP5)NPP5)
Classification : HYDROLASE
Molecule : ECTONUCLEOTIDE PYROPHOSPHATASE/PHOSPHODIESTERASE FAMILYMOLECULE: ECTONUCLEOTIDE PYROPHOSPHATASE/PHOSPHODIESTERASE FAMILY
5VENDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 1.69 Å
Title : NPP5)NPP5)
Classification : HYDROLASE
Molecule : ECTONUCLEOTIDE PYROPHOSPHATASE/PHOSPHODIESTERASE FAMILYMOLECULE: ECTONUCLEOTIDE PYROPHOSPHATASE/PHOSPHODIESTERASE FAMILY
5VEODeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 1.53 Å
Title : NPP5), INACTIVE (T72A), IN COMPLEX WITH AMPNPP5), INACTIVE (T72A), IN COMPLEX WITH AMP
Classification : HYDROLASE
Molecule : ECTONUCLEOTIDE PYROPHOSPHATASE/PHOSPHODIESTERASE FAMILYMOLECULE: ECTONUCLEOTIDE PYROPHOSPHATASE/PHOSPHODIESTERASE FAMILY
5VHGDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 1.27 Å
Title : CRYSTAL STRUCTURE OF PENTAD MUTANT GAPR-1RYSTAL STRUCTURE OF PENTAD MUTANT GAPR-1
Classification : PLANT PROTEIN
Molecule : GOLGI-ASSOCIATED PLANT PATHOGENESIS-RELATED PROTEIN 1;MOLECULE: GOLGI-ASSOCIATED PLANT PATHOGENESIS-RELATED PROTEIN 1;
5VIDDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.75 Å
Title : BOT.0671.2BOT.0671.2
Classification : TOXIN
Molecule : BOT.0671.2;MOLECULE: BOT.0671.2;
5VKODeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 1.80 Å
Title : SPT6 TSH2-RPB1 1468-1500 PT1471, PS1493PT6 TSH2-RPB1 1468-1500 PT1471, PS1493
Classification : TRANSCRIPTION
Molecule : DNA-DIRECTED RNA POLYMERASE II SUBUNIT RPB1;MOLECULE: DNA-DIRECTED RNA POLYMERASE II SUBUNIT RPB1;
5VLBDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.25 Å
Title : COMPLEX WITH IMIDAZOLECOMPLEX WITH IMIDAZOLE
Classification : OXIDOREDUCTASE
Molecule : HISTIDINOL DEHYDROGENASE, CHLOROPLASTIC;MOLECULE: HISTIDINOL DEHYDROGENASE, CHLOROPLASTIC;
5VLCDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 1.97 Å
Title : COMPLEX WITH L-HISTIDINOLCOMPLEX WITH L-HISTIDINOL
Classification : OXIDOREDUCTASE
Molecule : HISTIDINOL DEHYDROGENASE, CHLOROPLASTIC;MOLECULE: HISTIDINOL DEHYDROGENASE, CHLOROPLASTIC;
5VLDDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.59 Å
Title : COMPLEX WITH L-HISTIDINE AND NAD+COMPLEX WITH L-HISTIDINE AND NAD+
Classification : OXIDOREDUCTASE
Molecule : HISTIDINOL DEHYDROGENASE, CHLOROPLASTIC;MOLECULE: HISTIDINOL DEHYDROGENASE, CHLOROPLASTIC;
5VMRDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 1.95 Å
Title : BOT.2110.4BOT.2110.4
Classification : TOXIN
Molecule : BOT.2110.4;MOLECULE: BOT.2110.4;
5W3PDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 1.92 Å
Title : ANTIBODY C706 IN COMPLEX WTH BETA-AMYLOID PEPTIDE 1-16NTIBODY C706 IN COMPLEX WTH BETA-AMYLOID PEPTIDE 1-16
Classification : IMMUNE SYSTEM
Molecule : AMYLOID BETA A4 PROTEIN;MOLECULE: AMYLOID BETA A4 PROTEIN;
5W56Deposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.03 Å
Title : STRUCTURE OF APO AZTCTRUCTURE OF APO AZTC
Classification : METAL BINDING PROTEIN
Molecule : PERIPLASMIC SOLUTE BINDING PROTEIN;MOLECULE: PERIPLASMIC SOLUTE BINDING PROTEIN;
5W57Deposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.30 Å
Title : STRUCTURE OF HOLO AZTCTRUCTURE OF HOLO AZTC
Classification : METAL BINDING PROTEIN
Molecule : PERIPLASMIC SOLUTE BINDING PROTEIN;MOLECULE: PERIPLASMIC SOLUTE BINDING PROTEIN;
5WJLDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 3.15 Å
Title : CRYSTAL STRUCTURE OF HLA-A*11:01 WITH GTS1 PEPTIDERYSTAL STRUCTURE OF HLA-A*11:01 WITH GTS1 PEPTIDE
Classification : IMMUNE SYSTEM
Molecule : GTS1 PEPTIDE;MOLECULE: GTS1 PEPTIDE;
5WJNDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.85 Å
Title : CRYSTAL STRUCTURE OF HLA-A*11:01-GTS3RYSTAL STRUCTURE OF HLA-A*11:01-GTS3
Classification : IMMUNE SYSTEM
Molecule : GTS3 PEPTIDE;MOLECULE: GTS3 PEPTIDE;
5WKFDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.95 Å
Title : D30 TCR IN COMPLEX WITH HLA-A*11:01-GTS130 TCR IN COMPLEX WITH HLA-A*11:01-GTS1
Classification : IMMUNE SYSTEM
Molecule : D30 TCR BETA CHAIN;MOLECULE: D30 TCR BETA CHAIN;
5WKHDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 3.20 Å
Title : D30 TCR IN COMPLEX WITH HLA-A*11:01-GTS330 TCR IN COMPLEX WITH HLA-A*11:01-GTS3
Classification : IMMUNE SYSTEM
Molecule : D30 TCR BETA CHAIN;MOLECULE: D30 TCR BETA CHAIN;
5X1ADeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 1.82 Å
Title : CRYSTAL STRUCTURE OF HUMAN CRMP-2RYSTAL STRUCTURE OF HUMAN CRMP-2
Classification : PROTEIN BINDING
Molecule : DIHYDROPYRIMIDINASE-RELATED PROTEIN 2;MOLECULE: DIHYDROPYRIMIDINASE-RELATED PROTEIN 2;
5X1CDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.10 Å
Title : CRYSTAL STRUCTURE OF HUMAN CRMP-2 WITHOUT C-TERMINAL TAILRYSTAL STRUCTURE OF HUMAN CRMP-2 WITHOUT C-TERMINAL TAIL
Classification : PROTEIN BINDING
Molecule : DIHYDROPYRIMIDINASE-RELATED PROTEIN 2;MOLECULE: DIHYDROPYRIMIDINASE-RELATED PROTEIN 2;
5X1DDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.20 Å
Title : CRYSTAL STRUCTURE OF T246A-N247A HUMAN CRMP-2 MUTANTRYSTAL STRUCTURE OF T246A-N247A HUMAN CRMP-2 MUTANT
Classification : PROTEIN BINDING
Molecule : DIHYDROPYRIMIDINASE-RELATED PROTEIN 2;MOLECULE: DIHYDROPYRIMIDINASE-RELATED PROTEIN 2;
5X2RDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.70 Å
Title : PHOSPHATE PH 6.9.PHOSPHATE PH 6.9.
Classification : TRANSPORT PROTEIN
Molecule : HEMOGLOBIN SUBUNIT BETA;MOLECULE: HEMOGLOBIN SUBUNIT BETA;
5X2TDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.64 Å
Title : BEZAFIBRATE PH 7.2.BEZAFIBRATE PH 7.2.
Classification : TRANSPORT PROTEIN
Molecule : HEMOGLOBIN SUBUNIT BETA;MOLECULE: HEMOGLOBIN SUBUNIT BETA;
5X4ADeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 3.40 Å
Title : SLL-2-FORSSMAN ANTIGEN TETRASACCHARIDES COMPLEXLL-2-FORSSMAN ANTIGEN TETRASACCHARIDES COMPLEX
Classification : SUGAR BINDING PROTEIN
Molecule : GALACTOSE-BINDING LECTIN;MOLECULE: GALACTOSE-BINDING LECTIN;
5XAUDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 1.80 Å
Title : CRYSTAL STRUCTURE OF INTEGRIN BINDING FRAGMENT OF LAMININ-511RYSTAL STRUCTURE OF INTEGRIN BINDING FRAGMENT OF LAMININ-511
Classification : CELL ADHESION
Molecule : LAMININ SUBUNIT GAMMA-1;MOLECULE: LAMININ SUBUNIT GAMMA-1;
5XJJDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.90 Å
Title : CRYSTAL STRUCTURE OF A MATE FAMILY PROTEINRYSTAL STRUCTURE OF A MATE FAMILY PROTEIN
Classification : TRANSPORT PROTEIN
Molecule : MULTI DRUG EFFLUX TRANSPORTER;MOLECULE: MULTI DRUG EFFLUX TRANSPORTER;
5XKIDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.46 Å
Title : CRYSTAL STRUCTURE OF BACULOVIRAL SULFHYDRYL OXIDASE ACP33 (WIDE TYPE)RYSTAL STRUCTURE OF BACULOVIRAL SULFHYDRYL OXIDASE ACP33 (WIDE TYPE)
Classification : OXIDOREDUCTASE
Molecule : FAD-LINKED SULFHYDRYL OXIDASE;MOLECULE: FAD-LINKED SULFHYDRYL OXIDASE;
5XNLDeposited : 20-SEP-17  (New)      Exp.Method :ELECTRON MICROSCOPY with the resolution of 2.70 Å
Title : SATIVUMSATIVUM
Classification : MEMBRANE PROTEIN
Molecule : PHOTOSYSTEM II REACTION CENTER PROTEIN Z;MOLECULE: PHOTOSYSTEM II REACTION CENTER PROTEIN Z;
5XNMDeposited : 20-SEP-17  (New)      Exp.Method :ELECTRON MICROSCOPY with the resolution of 3.20 Å
Title : SATIVUMSATIVUM
Classification : MEMBRANE PROTEIN
Molecule : PHOTOSYSTEM II REACTION CENTER PROTEIN Z;MOLECULE: PHOTOSYSTEM II REACTION CENTER PROTEIN Z;
5XNNDeposited : 20-SEP-17  (New)      Exp.Method :ELECTRON MICROSCOPY with the resolution of 3.60 Å
Title : PSII-LHCII SUPERCOMPLEX FROM PISUM SATIVUMPSII-LHCII SUPERCOMPLEX FROM PISUM SATIVUM
Classification : MEMBRANE PROTEIN
Molecule : LIGHT HARVESTING CHLOROPHYLL A/B-BINDING PROTEIN LHCB6,MOLECULE: LIGHT HARVESTING CHLOROPHYLL A/B-BINDING PROTEIN LHCB6,
5XNODeposited : 20-SEP-17  (New)      Exp.Method :ELECTRON MICROSCOPY with the resolution of 3.50 Å
Title : PSII-LHCII SUPERCOMPLEX FROM PISUM SATIVUMPSII-LHCII SUPERCOMPLEX FROM PISUM SATIVUM
Classification : MEMBRANE PROTEIN
Molecule : LIGHT HARVESTING CHLOROPHYLL A/B-BINDING PROTEIN LHCB6,MOLECULE: LIGHT HARVESTING CHLOROPHYLL A/B-BINDING PROTEIN LHCB6,
5XPTDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.10 Å
Title : TETRAGONAL CRYSTALTETRAGONAL CRYSTAL
Classification : TRANSCRIPTION/METAL BINDING PROTEIN
Molecule : CHROMOSOME ALIGNMENT-MAINTAINING PHOSPHOPROTEIN 1;MOLECULE: CHROMOSOME ALIGNMENT-MAINTAINING PHOSPHOPROTEIN 1;
5XPUDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.30 Å
Title : MONOCLINIC CRYSTALMONOCLINIC CRYSTAL
Classification : TRANSCRIPTION/METAL BINDING PROTEIN
Molecule : CHROMOSOME ALIGNMENT-MAINTAINING PHOSPHOPROTEIN 1;MOLECULE: CHROMOSOME ALIGNMENT-MAINTAINING PHOSPHOPROTEIN 1;
5XUVDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 1.90 Å
Title : THIOTHYMINE BASE PAIRSTHIOTHYMINE BASE PAIRS
Classification : DNA
Molecule : DNA (5'-D(*CP*GP*CP*GP*AP*(8RO)P*(8RO)P*TP*CP*GP*CP*G)-3');MOLECULE: DNA (5'-D(*CP*GP*CP*GP*AP*(8RO)P*(8RO)P*TP*CP*GP*CP*G)-3');
5XXYDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.90 Å
Title : COMPLEX STRUCTURE OF PD-L1 WITH ATEZOLIZUMAB FABOMPLEX STRUCTURE OF PD-L1 WITH ATEZOLIZUMAB FAB
Classification : IMMUNE SYSTEM
Molecule : PROGRAMMED CELL DEATH 1 LIGAND 1;MOLECULE: PROGRAMMED CELL DEATH 1 LIGAND 1;
5Y48Deposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 1.70 Å
Title : RESOLUTIONRESOLUTION
Classification : HYDROLASE
Molecule : RIBOSOME INACTIVATING PROTEIN;MOLECULE: RIBOSOME INACTIVATING PROTEIN;
5Y4IDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 1.91 Å
Title : METAL BINDING MODEMETAL BINDING MODE
Classification : ISOMERASE
Molecule : XYLOSE ISOMERASE;MOLECULE: XYLOSE ISOMERASE;
5Y4JDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 1.40 Å
Title : INHIBITOR IN ONE METAL BINDING MODEINHIBITOR IN ONE METAL BINDING MODE
Classification : ISOMERASE
Molecule : XYLOSE ISOMERASE;MOLECULE: XYLOSE ISOMERASE;
5Y61Deposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.99 Å
Title : YFIB-YFIR COMPLEXED WITH GMPFIB-YFIR COMPLEXED WITH GMP
Classification : SIGNALING PROTEIN
Molecule : YFIB;MOLECULE: YFIB;
5Y62Deposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 3.00 Å
Title : YFIR COMPLEXED WITH GMPFIR COMPLEXED WITH GMP
Classification : SIGNALING PROTEIN
Molecule : YFIR;MOLECULE: YFIR;
5Y7YDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.40 Å
Title : CRYSTAL STRUCTURE OF AHRR/ARNT COMPLEXRYSTAL STRUCTURE OF AHRR/ARNT COMPLEX
Classification : TRANSCRIPTION
Molecule : ARYL HYDROCARBON RECEPTOR NUCLEAR TRANSLOCATOR;MOLECULE: ARYL HYDROCARBON RECEPTOR NUCLEAR TRANSLOCATOR;
5Y91Deposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 1.90 Å
Title : INSIGHTS INTO THE CONSERVED NATURE OF THE ANTIGEN-PRESENTING SYSTEMINSIGHTS INTO THE CONSERVED NATURE OF THE ANTIGEN-PRESENTING SYSTEM
Classification : IMMUNE SYSTEM
Molecule : PEPTIDE PHE-ALA-ASN-PHE-CYS-LEU-MET-MET-ILE;MOLECULE: PEPTIDE PHE-ALA-ASN-PHE-CYS-LEU-MET-MET-ILE;
5YDBDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 1.76 Å
Title : RESOLUTIONRESOLUTION
Classification : LYASE
Molecule : 3-DEHYDROQUINATE DEHYDRATASE;MOLECULE: 3-DEHYDROQUINATE DEHYDRATASE;
6ALTDeposited : 20-SEP-17  (New)      Exp.Method :SOLUTION NMR
Title : AND 9TH POSITIONAND 9TH POSITION
Classification : DNA
Molecule : DNA (5'-D(*(DC5)P*GP*(DMC)P*GP*AP*AP*TP*TP*(DMC)MOLECULE: DNA (5'-D(*(DC5)P*GP*(DMC)P*GP*AP*AP*TP*TP*(DMC)
6AMRDeposited : 20-SEP-17  (New)      Exp.Method :SOLUTION NMR
Title : GENOMICS CENTER FOR INFECTIOUS DISEASE TARGET EHCHA.00546.AGENOMICS CENTER FOR INFECTIOUS DISEASE TARGET EHCHA.00546.A
Classification : OXIDOREDUCTASE
Molecule : THIOREDOXIN;MOLECULE: THIOREDOXIN;
6ANJDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 1.70 Å
Title : SYNAPTOTAGMIN-7, C2A DOMAINYNAPTOTAGMIN-7, C2A DOMAIN
Classification : PROTEIN BINDING
Molecule : SYNAPTOTAGMIN-7;MOLECULE: SYNAPTOTAGMIN-7;
6ANKDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.25 Å
Title : SYNAPTOTAGMIN-7, C2A- AND C2B-DOMAINSYNAPTOTAGMIN-7, C2A- AND C2B-DOMAINS
Classification : PROTEIN BINDING
Molecule : SYNAPTOTAGMIN-7;MOLECULE: SYNAPTOTAGMIN-7;
6AR7Deposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.10 Å
Title : BURKHOLDERIA THAILANDENSISBURKHOLDERIA THAILANDENSIS
Classification : UNKNOWN FUNCTION
Molecule : UNCHARACTERIZED PROTEIN;MOLECULE: UNCHARACTERIZED PROTEIN;
6ATZDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.70 Å
Title : HLA-DRB1*1402 IN COMPLEX WITH CITRULLINATED FIBRINOGEN PEPTIDELA-DRB1*1402 IN COMPLEX WITH CITRULLINATED FIBRINOGEN PEPTIDE
Classification : IMMUNE SYSTEM
Molecule : FIBRINOGEN BETA CHAIN;MOLECULE: FIBRINOGEN BETA CHAIN;
6AVLDeposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.00 Å
Title : ORTHORHOMBIC TRYPSIN (295 K) IN THE PRESENCE OF 50% XYLOSERTHORHOMBIC TRYPSIN (295 K) IN THE PRESENCE OF 50% XYLOSE
Classification : HYDROLASE
Molecule : CATIONIC TRYPSIN;MOLECULE: CATIONIC TRYPSIN;
6AY1Deposited : 20-SEP-17  (New)      Exp.Method :X-RAY DIFFRACTION with the resolution of 2.05 Å
Title : HELICOBACTER PYLORIHELICOBACTER PYLORI
Classification : TRANSFERASE
Molecule : NUCLEOSIDE DIPHOSPHATE KINASE;MOLECULE: NUCLEOSIDE DIPHOSPHATE KINASE;
1HH8Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.80 Å
Title : IMPLICATED IN CHRONIC GRANULOMATOUS DISEASEIMPLICATED IN CHRONIC GRANULOMATOUS DISEASE
Classification : CELL CYCLE
Molecule : NEUTROPHIL CYTOSOL FACTOR 2;MOLECULE: NEUTROPHIL CYTOSOL FACTOR 2;
2FWVDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.70 Å
Title : CRYSTAL STRUCTURE OF RV0813RYSTAL STRUCTURE OF RV0813
Classification : STRUCTURAL GENOMICS, UNKNOWN FUNCTION
Molecule : HYPOTHETICAL PROTEIN MTUBF_01000852;MOLECULE: HYPOTHETICAL PROTEIN MTUBF_01000852;
2N9ADeposited : 20-SEP-17  (Revised)     Exp.Method :SOLUTION NMR
Title : 3D STRUCTURE OF DECORALIN-NH2 BY SOLUTION NMRD STRUCTURE OF DECORALIN-NH2 BY SOLUTION NMR
Classification : ANTIMICROBIAL PROTEIN
Molecule : DECORALIN;MOLECULE: DECORALIN;
3GQODeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.60 Å
Title : VIRUS IN COMPLEX WITH ADP-RIBOSEVIRUS IN COMPLEX WITH ADP-RIBOSE
Classification : VIRAL PROTEIN
Molecule : NON-STRUCTURAL PROTEIN 3;MOLECULE: NON-STRUCTURAL PROTEIN 3;
3KW3Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.04 Å
Title : COVALENTLY BOUND PYRIDOXAL PHOSPHATECOVALENTLY BOUND PYRIDOXAL PHOSPHATE
Classification : ISOMERASE
Molecule : ALANINE RACEMASE;MOLECULE: ALANINE RACEMASE;
3S6LDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.30 Å
Title : IODIDE ION SAD PHASINGIODIDE ION SAD PHASING
Classification : CELL ADHESION
Molecule : HEP_HAG FAMILY;MOLECULE: HEP_HAG FAMILY;
3TGXDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.80 Å
Title : IL-21:IL21R COMPLEXL-21:IL21R COMPLEX
Classification : CYTOKINE/CYTOKINE RECEPTOR
Molecule : INTERLEUKIN-21;MOLECULE: INTERLEUKIN-21;
4E0LDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.70 Å
Title : 54-MEMBERED MACROCYCLE SCAFFOLD54-MEMBERED MACROCYCLE SCAFFOLD
Classification : PROTEIN FIBRIL
Molecule : CYCLIC PSEUDO-PEPTIDE FYLLYYT(ORN)KN(HAO)SA(ORN);MOLECULE: CYCLIC PSEUDO-PEPTIDE FYLLYYT(ORN)KN(HAO)SA(ORN);
4GNDDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.27 Å
Title : CRYSTAL STRUCTURE OF NSD3 TANDEM PHD5-C5HCH DOMAINSRYSTAL STRUCTURE OF NSD3 TANDEM PHD5-C5HCH DOMAINS
Classification : TRANSFERASE
Molecule : HISTONE-LYSINE N-METHYLTRANSFERASE NSD3;MOLECULE: HISTONE-LYSINE N-METHYLTRANSFERASE NSD3;
4H05Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.15 Å
Title : CRYSTAL STRUCTURE OF AMINOGLYCOSIDE-3'-PHOSPHOTRANSFERASE OF TYPE VIIIRYSTAL STRUCTURE OF AMINOGLYCOSIDE-3'-PHOSPHOTRANSFERASE OF TYPE VIII
Classification : TRANSFERASE
Molecule : AMINOGLYCOSIDE-O-PHOSPHOTRANSFERASE VIII;MOLECULE: AMINOGLYCOSIDE-O-PHOSPHOTRANSFERASE VIII;
4HECDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.80 Å
Title : MYCOBACTERIUM TUBERCULOSISMYCOBACTERIUM TUBERCULOSIS
Classification : UNKNOWN FUNCTION
Molecule : PUTATIVE UNCHARACTERIZED PROTEIN;MOLECULE: PUTATIVE UNCHARACTERIZED PROTEIN;
4HJHDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.10 Å
Title : BRUCELLA MELITENSIS COMPLEXED WITH GLUCOSE-6-PHOSPHATEBRUCELLA MELITENSIS COMPLEXED WITH GLUCOSE-6-PHOSPHATE
Classification : ISOMERASE
Molecule : PHOSPHOMANNOMUTASE;MOLECULE: PHOSPHOMANNOMUTASE;
4HU9Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.55 Å
Title : RESIDUERESIDUE
Classification : OXIDOREDUCTASE
Molecule : THIOREDOXIN-1;MOLECULE: THIOREDOXIN-1;
4I1MDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.80 Å
Title : CRYSTAL STRUCTURE OF THE LEGIONELLA PNEUMOPHILA GAP DOMAIN OF LEPBRYSTAL STRUCTURE OF THE LEGIONELLA PNEUMOPHILA GAP DOMAIN OF LEPB
Classification : HYDROLASE
Molecule : LEPB;MOLECULE: LEPB;
4IB6Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.20 Å
Title : (C12)(C12)
Classification : TRANSPORT PROTEIN
Molecule : BETA-LACTOGLOBULIN;MOLECULE: BETA-LACTOGLOBULIN;
4IB7Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.20 Å
Title : DODECYLTRIMETHYLAMMONIUM (DTAC)DODECYLTRIMETHYLAMMONIUM (DTAC)
Classification : TRANSPORT PROTEIN
Molecule : BETA-LACTOGLOBULIN;MOLECULE: BETA-LACTOGLOBULIN;
4IB8Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.30 Å
Title : (SDS)(SDS)
Classification : TRANSPORT PROTEIN
Molecule : BETA-LACTOGLOBULIN;MOLECULE: BETA-LACTOGLOBULIN;
4JFBDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 3.80 Å
Title : CRYSTAL STRUCTURE OF OMPF IN C2 WITH TNCSRYSTAL STRUCTURE OF OMPF IN C2 WITH TNCS
Classification : MEMBRANE PROTEIN
Molecule : OUTER MEMBRANE PROTEIN F;MOLECULE: OUTER MEMBRANE PROTEIN F;
4MMRDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 3.10 Å
Title : CRYSTAL STRUCTURE OF PREFUSION-STABILIZED RSV F VARIANT CAV1 AT PH 9.5RYSTAL STRUCTURE OF PREFUSION-STABILIZED RSV F VARIANT CAV1 AT PH 9.5
Classification : VIRAL PROTEIN
Molecule : FUSION GLYCOPROTEIN F1 FUSED WITH FIBRITIN TRIMERIZATIONMOLECULE: FUSION GLYCOPROTEIN F1 FUSED WITH FIBRITIN TRIMERIZATION
4MMSDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.40 Å
Title : CRYSTAL STRUCTURE OF PREFUSION-STABILIZED RSV F VARIANT CAV1 AT PH 5.5RYSTAL STRUCTURE OF PREFUSION-STABILIZED RSV F VARIANT CAV1 AT PH 5.5
Classification : VIRAL PROTEIN
Molecule : FUSION GLYCOPROTEIN F1 FUSED WITH FIBRITIN TRIMERIZATIONMOLECULE: FUSION GLYCOPROTEIN F1 FUSED WITH FIBRITIN TRIMERIZATION
4MMUDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 3.00 Å
Title : 5.55.5
Classification : VIRAL PROTEIN
Molecule : FUSION GLYCOPROTEIN F1 FUSED WITH FIBRITIN TRIMERIZATIONMOLECULE: FUSION GLYCOPROTEIN F1 FUSED WITH FIBRITIN TRIMERIZATION
4MMVDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.81 Å
Title : AT PH 9.5AT PH 9.5
Classification : VIRAL PROTEIN
Molecule : FUSION GLYCOPROTEIN F1 FUSED WITH FIBRITIN TRIMERIZATIONMOLECULE: FUSION GLYCOPROTEIN F1 FUSED WITH FIBRITIN TRIMERIZATION
4NDSDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.00 Å
Title : CRYSTAL STRUCTURE OF L. DECASTES ALPHA-GALACTOSYL-BINDING LECTINRYSTAL STRUCTURE OF L. DECASTES ALPHA-GALACTOSYL-BINDING LECTIN
Classification : SUGAR BINDING PROTEIN
Molecule : ALPHA-GALACTOSYL-BINDING LECTIN;MOLECULE: ALPHA-GALACTOSYL-BINDING LECTIN;
4NNTDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.53 Å
Title : CRYSTAL STRUCTURE OF FABP4 IN COMPLEX WITH NOVEL INHIBITORRYSTAL STRUCTURE OF FABP4 IN COMPLEX WITH NOVEL INHIBITOR
Classification : LIPID BINDING PROTEIN/INHIBITOR
Molecule : FATTY ACID-BINDING PROTEIN, ADIPOCYTE;MOLECULE: FATTY ACID-BINDING PROTEIN, ADIPOCYTE;
4NWPDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.10 Å
Title : CAGE, T33-21, CRYSTALLIZED IN SPACE GROUP R32CAGE, T33-21, CRYSTALLIZED IN SPACE GROUP R32
Classification : PROTEIN BINDING
Molecule : UNCHARACTERIZED PROTEIN;MOLECULE: UNCHARACTERIZED PROTEIN;
4OWPDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.35 Å
Title : REPRESENTING THE ACTIVE PORTION OF THE PROTEOSOME LID.REPRESENTING THE ACTIVE PORTION OF THE PROTEOSOME LID.
Classification : HYDROLASE
Molecule : 26S PROTEASOME REGULATORY SUBUNIT RPN11;MOLECULE: 26S PROTEASOME REGULATORY SUBUNIT RPN11;
4OWRDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 3.15 Å
Title : NUCLEOPORIN PAIR RAE1-NUP98NUCLEOPORIN PAIR RAE1-NUP98
Classification : TRANSPORT PROTEIN
Molecule : MATRIX PROTEIN;MOLECULE: MATRIX PROTEIN;
4OX2Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.00 Å
Title : SULFOPYRUVATE AND GTPSULFOPYRUVATE AND GTP
Classification : LYASE
Molecule : PHOSPHOENOLPYRUVATE CARBOXYKINASE, CYTOSOLIC [GTP];MOLECULE: PHOSPHOENOLPYRUVATE CARBOXYKINASE, CYTOSOLIC [GTP];
4OXIDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.26 Å
Title : COMPLEX WITH GLYCYL-ADENOSINE-5'-PHOSPHATECOMPLEX WITH GLYCYL-ADENOSINE-5'-PHOSPHATE
Classification : LIGASE
Molecule : ENTEROBACTIN SYNTHETASE COMPONENT F-RELATED PROTEIN;MOLECULE: ENTEROBACTIN SYNTHETASE COMPONENT F-RELATED PROTEIN;
4OXSDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.80 Å
Title : STRUCTURE OF NAVMS IN COMPLEX WITH CHANNEL BLOCKING COMPOUNDTRUCTURE OF NAVMS IN COMPLEX WITH CHANNEL BLOCKING COMPOUND
Classification : TRANSPORT PROTEIN
Molecule : ION TRANSPORT PROTEIN;MOLECULE: ION TRANSPORT PROTEIN;
4OXXDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.21 Å
Title : CRYSTAL STRUCTURE OF CINDOXIN, SURFACE ENTROPY REDUCTION MUTANTRYSTAL STRUCTURE OF CINDOXIN, SURFACE ENTROPY REDUCTION MUTANT
Classification : ELECTRON TRANSPORT
Molecule : CINDOXIN;MOLECULE: CINDOXIN;
4OZ0Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.20 Å
Title : CRYSTAL STRUCTURE OF HUMAN CAPERALPHA U2AF HOMOLOGY MOTIF (APO-STATE)RYSTAL STRUCTURE OF HUMAN CAPERALPHA U2AF HOMOLOGY MOTIF (APO-STATE)
Classification : TRANSCRIPTION
Molecule : RNA-BINDING PROTEIN 39;MOLECULE: RNA-BINDING PROTEIN 39;
4OZ1Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.74 Å
Title : CRYSTAL STRUCTURE OF HUMAN CAPERALPHA UHM BOUND TO SF3B155 ULM5RYSTAL STRUCTURE OF HUMAN CAPERALPHA UHM BOUND TO SF3B155 ULM5
Classification : TRANSCRIPTION
Molecule : SPLICING FACTOR 3B SUBUNIT 1;MOLECULE: SPLICING FACTOR 3B SUBUNIT 1;
4P1EDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.90 Å
Title : STRUCTURE, PHASED WITH IODIDESTRUCTURE, PHASED WITH IODIDE
Classification : TRANSPORT PROTEIN
Molecule : TRAP DICARBOXYLATE TRANSPORTER, DCTP SUBUNIT;MOLECULE: TRAP DICARBOXYLATE TRANSPORTER, DCTP SUBUNIT;
4P1LDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.70 Å
Title : WITH BOUND D-GLUCURONATE, SPG I213WITH BOUND D-GLUCURONATE, SPG I213
Classification : TRANSPORT PROTEIN
Molecule : TRAP DICARBOXYLATE TRANSPORTER, DCTP SUBUNIT;MOLECULE: TRAP DICARBOXYLATE TRANSPORTER, DCTP SUBUNIT;
4P1MDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.95 Å
Title : THE STRUCTURE OF ESCHERICHIA COLI ZAPAHE STRUCTURE OF ESCHERICHIA COLI ZAPA
Classification : CELL CYCLE
Molecule : CELL DIVISION PROTEIN ZAPA;MOLECULE: CELL DIVISION PROTEIN ZAPA;
4P2HDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.99 Å
Title : ACTIVE SITEACTIVE SITE
Classification : TRANSFERASE/DNA
Molecule : DNA (5'-D(P*GP*TP*CP*GP*G)-3');MOLECULE: DNA (5'-D(P*GP*TP*CP*GP*G)-3');
4P2ODeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.60 Å
Title : CRYSTAL STRUCTURE OF THE 2B4 TCR IN COMPLEX WITH 2A/I-EKRYSTAL STRUCTURE OF THE 2B4 TCR IN COMPLEX WITH 2A/I-EK
Classification : IMMUNE SYSTEM
Molecule : 2A PEPTIDE;MOLECULE: 2A PEPTIDE;
4P2QDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 3.30 Å
Title : CRYSTAL STRUCTURE OF THE 5CC7 TCR IN COMPLEX WITH 5C2/I-EKRYSTAL STRUCTURE OF THE 5CC7 TCR IN COMPLEX WITH 5C2/I-EK
Classification : IMMUNE SYSTEM
Molecule : 5CC7 T-CELL RECEPTOR BETA CHAIN;MOLECULE: 5CC7 T-CELL RECEPTOR BETA CHAIN;
4P2TDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.15 Å
Title : PROTEASE IN COMPLEX WITH A DIMER DISRUPTORPROTEASE IN COMPLEX WITH A DIMER DISRUPTOR
Classification : HYDROLASE
Molecule : KSHV PROTEASE;MOLECULE: KSHV PROTEASE;
4P31Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.05 Å
Title : COMPLEX WITH ADP-MAGENSIUMCOMPLEX WITH ADP-MAGENSIUM
Classification : HYDROLASE
Molecule : LIPOPOLYSACCHARIDE EXPORT SYSTEM ATP-BINDING PROTEIN LPTB;MOLECULE: LIPOPOLYSACCHARIDE EXPORT SYSTEM ATP-BINDING PROTEIN LPTB;
4P32Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.55 Å
Title : CRYSTAL STRUCTURE OF E. COLI LPTB IN COMPLEX WITH ADP-MAGNESIUMRYSTAL STRUCTURE OF E. COLI LPTB IN COMPLEX WITH ADP-MAGNESIUM
Classification : HYDROLASE
Molecule : LIPOPOLYSACCHARIDE EXPORT SYSTEM ATP-BINDING PROTEIN LPTB;MOLECULE: LIPOPOLYSACCHARIDE EXPORT SYSTEM ATP-BINDING PROTEIN LPTB;
4P33Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.65 Å
Title : CRYSTAL STRUCTURE OF E. COLI LPTB-E163Q IN COMPLEX WITH ATP-SODIUMRYSTAL STRUCTURE OF E. COLI LPTB-E163Q IN COMPLEX WITH ATP-SODIUM
Classification : HYDROLASE
Molecule : LIPOPOLYSACCHARIDE EXPORT SYSTEM ATP-BINDING PROTEIN LPTB;MOLECULE: LIPOPOLYSACCHARIDE EXPORT SYSTEM ATP-BINDING PROTEIN LPTB;
4P3HDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.45 Å
Title : PROTEASE IN COMPLEX WITH DIMER DISRUPTORPROTEASE IN COMPLEX WITH DIMER DISRUPTOR
Classification : HYDROLASE
Molecule : KSHV PROTEASE;MOLECULE: KSHV PROTEASE;
4P4GDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.70 Å
Title : DEHYDROGENASEDEHYDROGENASE
Classification : OXIDOREDUCTASE
Molecule : SHIKIMATE 5-DEHYDROGENASE AROE (5-DEHYDROSHIKIMATEMOLECULE: SHIKIMATE 5-DEHYDROGENASE AROE (5-DEHYDROSHIKIMATE
4P4LDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.01 Å
Title : DEHYDROGENASEDEHYDROGENASE
Classification : OXIDOREDUCTASE
Molecule : SHIKIMATE 5-DEHYDROGENASE AROE (5-DEHYDROSHIKIMATEMOLECULE: SHIKIMATE 5-DEHYDROGENASE AROE (5-DEHYDROSHIKIMATE
4P4NDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.95 Å
Title : DEHYDROGENASEDEHYDROGENASE
Classification : OXIDOREDUCTASE
Molecule : SHIKIMATE 5-DEHYDROGENASE AROE (5-DEHYDROSHIKIMATEMOLECULE: SHIKIMATE 5-DEHYDROGENASE AROE (5-DEHYDROSHIKIMATE
4P53Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.10 Å
Title : SUBSP. JINGGANGENSIS 5008 WITH NAD+ AND ZN2+ BOUNDSUBSP. JINGGANGENSIS 5008 WITH NAD+ AND ZN2+ BOUND
Classification : LYASE
Molecule : CYCLASE;MOLECULE: CYCLASE;
4P66Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.84 Å
Title : ELECTROSTATICS OF ACTIVE SITE MICROENVIRONMENTS OF E. COLI DHFRLECTROSTATICS OF ACTIVE SITE MICROENVIRONMENTS OF E. COLI DHFR
Classification : OXIDOREDUCTASE
Molecule : DIHYDROFOLATE REDUCTASE;MOLECULE: DIHYDROFOLATE REDUCTASE;
4P68Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.26 Å
Title : ELECTROSTATICS OF ACTIVE SITE MICROENVIRONMENTS FOR E. COLI DHFRLECTROSTATICS OF ACTIVE SITE MICROENVIRONMENTS FOR E. COLI DHFR
Classification : OXIDOREDUCTASE
Molecule : DIHYDROFOLATE REDUCTASE;MOLECULE: DIHYDROFOLATE REDUCTASE;
4P6JDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.80 Å
Title : METALLOTRANSPORTER WITH 4-BROMOPHENYLALANINE IN OCTYL GLUCOSIDEMETALLOTRANSPORTER WITH 4-BROMOPHENYLALANINE IN OCTYL GLUCOSIDE
Classification : DE NOVO PROTEIN
Molecule : COMPUTATIONALLY DESIGNED TRANSPORTER OF ZN(II) AND PROTON;MOLECULE: COMPUTATIONALLY DESIGNED TRANSPORTER OF ZN(II) AND PROTON;
4P6KDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of PACE. Å
Title : METALLOTRANSPORTER WITH 4-BROMOPHENYLALANINE IN LIPIDIC CUBIC PHASEMETALLOTRANSPORTER WITH 4-BROMOPHENYLALANINE IN LIPIDIC CUBIC PHASE
Classification : DE NOVO PROTEIN
Molecule : COMPUTATIONALLY DESIGNED TRANSPORTER OF ZN(II) AND PROTON;MOLECULE: COMPUTATIONALLY DESIGNED TRANSPORTER OF ZN(II) AND PROTON;
4P6LDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.80 Å
Title : METALLOTRANSPORTER IN OCTYL GLUCOSIDEMETALLOTRANSPORTER IN OCTYL GLUCOSIDE
Classification : DE NOVO PROTEIN
Molecule : COMPUTATIONALLY DESIGNED TRANSPORTER OF ZN(II) AND PROTON;MOLECULE: COMPUTATIONALLY DESIGNED TRANSPORTER OF ZN(II) AND PROTON;
4P7TDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.72 Å
Title : BACTERIAL MICROCOMPARTMENT PROTEIN PDUABACTERIAL MICROCOMPARTMENT PROTEIN PDUA
Classification : STRUCTURAL PROTEIN, ELECTRON TRANSPORT
Molecule : POLYHEDRAL BODIES;MOLECULE: POLYHEDRAL BODIES;
4P8BDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.30 Å
Title : (S)-2-HYDROXY-2-METHYL-3-OXOBUTANOATE ((S)-2-ACETOLACTATE)(S)-2-HYDROXY-2-METHYL-3-OXOBUTANOATE ((S)-2-ACETOLACTATE)
Classification : TRANSPORT PROTEIN
Molecule : TRAP-TYPE TRANSPORTER, PERIPLASMIC COMPONENT;MOLECULE: TRAP-TYPE TRANSPORTER, PERIPLASMIC COMPONENT;
4P96Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.20 Å
Title : FADR, FATTY ACID RESPONSIVE TRANSCRIPTION FACTOR FROM VIBRIO CHOLERAEADR, FATTY ACID RESPONSIVE TRANSCRIPTION FACTOR FROM VIBRIO CHOLERAE
Classification : TRANSCRIPTION
Molecule : FATTY ACID METABOLISM REGULATOR PROTEIN;MOLECULE: FATTY ACID METABOLISM REGULATOR PROTEIN;
4P97Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.86 Å
Title : RESPONSIVE RNA SWITCHESRESPONSIVE RNA SWITCHES
Classification : RNA
Molecule : RNA (5'-R(*CP*GP*AP*GP*AP*GP*GP*AP*CP*GP*G)-3');MOLECULE: RNA (5'-R(*CP*GP*AP*GP*AP*GP*GP*AP*CP*GP*G)-3');
4P9KDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.40 Å
Title : COPURIFIED ALTERNATIVE LIGAND.COPURIFIED ALTERNATIVE LIGAND.
Classification : TRANSPORT PROTEIN
Molecule : TRAP DICARBOXYLATE TRANSPORTER, DCTP SUBUNIT;MOLECULE: TRAP DICARBOXYLATE TRANSPORTER, DCTP SUBUNIT;
4P9ODeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.89 Å
Title : BLOCKING COMPOUNDBLOCKING COMPOUND
Classification : TRANSPORT PROTEIN
Molecule : ION TRANSPORT PROTEIN;MOLECULE: ION TRANSPORT PROTEIN;
4P9PDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.91 Å
Title : STRUCTURE OF NAVMS IN COMPLEX WITH CHANNEL BLOCKING COMPOUNDTRUCTURE OF NAVMS IN COMPLEX WITH CHANNEL BLOCKING COMPOUND
Classification : TRANSPORT PROTEIN
Molecule : ION TRANSPORT PROTEIN;MOLECULE: ION TRANSPORT PROTEIN;
4P9UDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 3.21 Å
Title : IN COMPLEX WITH DNAIN COMPLEX WITH DNA
Classification : TRANSCRIPTION REGULATOR/DNA
Molecule : DNA (31-MER);MOLECULE: DNA (31-MER);
4PA3Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 3.25 Å
Title : STRUCTURE OF NAVMS IN COMPLEX WITH CHANNEL BLOCKING COMPOUNDTRUCTURE OF NAVMS IN COMPLEX WITH CHANNEL BLOCKING COMPOUND
Classification : TRANSPORT PROTEIN
Molecule : ION TRANSPORT PROTEIN;MOLECULE: ION TRANSPORT PROTEIN;
4PA4Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 3.02 Å
Title : STRUCTURE OF NAVMS IN COMPLEX WITH CHANNEL BLOCKING COMPOUNDTRUCTURE OF NAVMS IN COMPLEX WITH CHANNEL BLOCKING COMPOUND
Classification : TRANSPORT PROTEIN
Molecule : ION TRANSPORT PROTEIN;MOLECULE: ION TRANSPORT PROTEIN;
4PA6Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 3.36 Å
Title : PRESENCE OF CHANNEL BLOCKING COMPOUNDPRESENCE OF CHANNEL BLOCKING COMPOUND
Classification : TRANSPORT PROTEIN
Molecule : ION TRANSPORT PROTEIN;MOLECULE: ION TRANSPORT PROTEIN;
4PA7Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 3.02 Å
Title : OF CHANNEL BLOCKING COMPOUNDOF CHANNEL BLOCKING COMPOUND
Classification : TRANSPORT PROTEIN
Molecule : ION TRANSPORT PROTEIN;MOLECULE: ION TRANSPORT PROTEIN;
4PA9Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 3.43 Å
Title : STRUCTURE OF NAVMS IN COMPLEX WITH CHANNEL BLOCKING COMPOUNDTRUCTURE OF NAVMS IN COMPLEX WITH CHANNEL BLOCKING COMPOUND
Classification : TRANSPORT PROTEIN
Molecule : ION TRANSPORT PROTEIN;MOLECULE: ION TRANSPORT PROTEIN;
4PARDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.89 Å
Title : COMPLEX WITH PRODUCT-LIKE DNACOMPLEX WITH PRODUCT-LIKE DNA
Classification : DNA BINDING PROTEIN/DNA
Molecule : UNCHARACTERIZED PROTEIN ABASI;MOLECULE: UNCHARACTERIZED PROTEIN ABASI;
4PB1Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.80 Å
Title : STRUCTURE OF VCCNT-7C8C BOUND TO RIBAVIRINTRUCTURE OF VCCNT-7C8C BOUND TO RIBAVIRIN
Classification : TRANSPORT PROTEIN
Molecule : NUPC FAMILY PROTEIN;MOLECULE: NUPC FAMILY PROTEIN;
4PB2Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.30 Å
Title : STRUCTURE OF VCCNT-7C8C BOUND TO 5-FLUOROURIDINETRUCTURE OF VCCNT-7C8C BOUND TO 5-FLUOROURIDINE
Classification : TRANSPORT PROTEIN
Molecule : NUPC FAMILY PROTEIN;MOLECULE: NUPC FAMILY PROTEIN;
4PBRDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.90 Å
Title : BOUND TO 4-(2-BROMOISOBUTYRAMIDO)-PHENYLALANINE (BIBAF)BOUND TO 4-(2-BROMOISOBUTYRAMIDO)-PHENYLALANINE (BIBAF)
Classification : LIGASE
Molecule : TYROSINE--TRNA LIGASE;MOLECULE: TYROSINE--TRNA LIGASE;
4PBSDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.01 Å
Title : BOUND TO 4-(2-BROMOISOBUTYRAMIDO)-PHENYLALANINE (BIBAF)BOUND TO 4-(2-BROMOISOBUTYRAMIDO)-PHENYLALANINE (BIBAF)
Classification : LIGASE
Molecule : TYROSINE--TRNA LIGASE;MOLECULE: TYROSINE--TRNA LIGASE;
4PBTDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.90 Å
Title : BOUND TO 4-TRANS-CYCLOOCTENE-AMIDOPHEYLALANINE (TCO-AMF)BOUND TO 4-TRANS-CYCLOOCTENE-AMIDOPHEYLALANINE (TCO-AMF)
Classification : LIGASE
Molecule : TYROSINE--TRNA LIGASE;MOLECULE: TYROSINE--TRNA LIGASE;
4PCVDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.05 Å
Title : THE STRUCTURE OF BDCA (YJGI) FROM E. COLIHE STRUCTURE OF BDCA (YJGI) FROM E. COLI
Classification : OXIDOREDUCTASE
Molecule : BDCA (YJGI);MOLECULE: BDCA (YJGI);
4PD5Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.91 Å
Title : CRYSTAL STRUCTURE OF VCCNT-7C8C BOUND TO GEMCITABINERYSTAL STRUCTURE OF VCCNT-7C8C BOUND TO GEMCITABINE
Classification : TRANSPORT PROTEIN
Molecule : NUPC FAMILY PROTEIN;MOLECULE: NUPC FAMILY PROTEIN;
4PD6Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.08 Å
Title : CRYSTAL STRUCTURE OF VCCNT-7C8C BOUND TO URIDINERYSTAL STRUCTURE OF VCCNT-7C8C BOUND TO URIDINE
Classification : TRANSPORT PROTEIN
Molecule : NUPC FAMILY PROTEIN;MOLECULE: NUPC FAMILY PROTEIN;
4PD7Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.91 Å
Title : STRUCTURE OF VCCNT BOUND TO ZEBULARINETRUCTURE OF VCCNT BOUND TO ZEBULARINE
Classification : TRANSPORT PROTEIN
Molecule : NUPC FAMILY PROTEIN;MOLECULE: NUPC FAMILY PROTEIN;
4PD8Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.75 Å
Title : STRUCTURE OF VCCNT-7C8C BOUND TO PYRROLO-CYTIDINETRUCTURE OF VCCNT-7C8C BOUND TO PYRROLO-CYTIDINE
Classification : TRANSPORT PROTEIN
Molecule : NUPC FAMILY PROTEIN;MOLECULE: NUPC FAMILY PROTEIN;
4PD9Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 3.10 Å
Title : STRUCTURE OF VCCNT-7C8C BOUND TO ADENOSINETRUCTURE OF VCCNT-7C8C BOUND TO ADENOSINE
Classification : TRANSPORT PROTEIN
Molecule : NUPC FAMILY PROTEIN;MOLECULE: NUPC FAMILY PROTEIN;
4PDADeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.61 Å
Title : STRUCTURE OF VCCNT-7C8C BOUND TO CYTIDINETRUCTURE OF VCCNT-7C8C BOUND TO CYTIDINE
Classification : TRANSPORT PROTEIN
Molecule : NUPC FAMILY PROTEIN;MOLECULE: NUPC FAMILY PROTEIN;
4PDJDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION; NEUTRON DIFFRACTION with the resolution of 1.60 Å
Title : WITH FOLATE AND NADP+WITH FOLATE AND NADP+
Classification : OXIDOREDUCTASE
Molecule : DIHYDROFOLATE REDUCTASE;MOLECULE: DIHYDROFOLATE REDUCTASE;
4PDKDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.80 Å
Title : IN COMPLEX WITH OLEOYL-COAIN COMPLEX WITH OLEOYL-COA
Classification : TRANSCRIPTION
Molecule : FATTY ACID METABOLISM REGULATOR PROTEIN;MOLECULE: FATTY ACID METABOLISM REGULATOR PROTEIN;
4PGNDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.80 Å
Title : INDOLE PYRUVATEINDOLE PYRUVATE
Classification : TRANSPORT PROTEIN
Molecule : EXTRACELLULAR SOLUTE-BINDING PROTEIN, FAMILY 7;MOLECULE: EXTRACELLULAR SOLUTE-BINDING PROTEIN, FAMILY 7;
4PGQDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.30 Å
Title : TEMPLATE BASE PAIRED WITH INCOMING NON-HYDROLYZABLE TTPTEMPLATE BASE PAIRED WITH INCOMING NON-HYDROLYZABLE TTP
Classification : TRANSFERASE,LYASE/DNA
Molecule : DNA (5'-D(P*GP*TP*CP*GP*G)-3');MOLECULE: DNA (5'-D(P*GP*TP*CP*GP*G)-3');
4PGRDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.95 Å
Title : CRYSTAL STRUCTURE OF YETJ FROM BACILLUS SUBTILIS AT PH 8RYSTAL STRUCTURE OF YETJ FROM BACILLUS SUBTILIS AT PH 8
Classification : MEMBRANCE PROTEIN
Molecule : UNCHARACTERIZED PROTEIN YETJ;MOLECULE: UNCHARACTERIZED PROTEIN YETJ;
4PGUDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 3.40 Å
Title : CRYSTAL STRUCTURE OF YETJ FROM BACILLUS SUBTILIS AT PH 7 BY SOAKINGRYSTAL STRUCTURE OF YETJ FROM BACILLUS SUBTILIS AT PH 7 BY SOAKING
Classification : MEMBRANCE PROTEIN
Molecule : UNCHARACTERIZED PROTEIN YETJ;MOLECULE: UNCHARACTERIZED PROTEIN YETJ;
4PGVDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.61 Å
Title : SOAKINGSOAKING
Classification : MEMBRANCE PROTEIN
Molecule : UNCHARACTERIZED PROTEIN YETJ;MOLECULE: UNCHARACTERIZED PROTEIN YETJ;
4PGWDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 3.60 Å
Title : CRYSTAL STRUCTURE OF YETJ FROM BACILLUS SUBTILIS AT PH 6 BY PT-SADRYSTAL STRUCTURE OF YETJ FROM BACILLUS SUBTILIS AT PH 6 BY PT-SAD
Classification : MEMBRANCE PROTEIN
Molecule : UNCHARACTERIZED PROTEIN YETJ;MOLECULE: UNCHARACTERIZED PROTEIN YETJ;
4PGXDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.08 Å
Title : TEMPLATE BASE PAIRED WITH INCOMING NON-HYDROLYZABLE TTP AND MANGANESETEMPLATE BASE PAIRED WITH INCOMING NON-HYDROLYZABLE TTP AND MANGANESE
Classification : TRANSFERASE,LYASE/DNA
Molecule : DNA POLYMERASE BETA;MOLECULE: DNA POLYMERASE BETA;
4PGYDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.26 Å
Title : CONTAINING A GT AT N-1 POSITION AND GC AT N POSITIONCONTAINING A GT AT N-1 POSITION AND GC AT N POSITION
Classification : TRANSFERASE,LYASE/DNA
Molecule : DNA (5'-D(P*GP*TP*CP*GP*G)-3');MOLECULE: DNA (5'-D(P*GP*TP*CP*GP*G)-3');
4PH5Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.55 Å
Title : CONTAINING A AC AT N-1 POSITION AND GC AT N POSITIONCONTAINING A AC AT N-1 POSITION AND GC AT N POSITION
Classification : TRANSFERASE,LYASE/DNA
Molecule : DNA POLYMERASE BETA;MOLECULE: DNA POLYMERASE BETA;
4PHADeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.52 Å
Title : TEMPLATE BASE PAIRED WITH INCOMING NON-HYDROLYZABLE CTPTEMPLATE BASE PAIRED WITH INCOMING NON-HYDROLYZABLE CTP
Classification : TRANSFERASE,LYASE/DNA
Molecule : DNA (5'-D(P*GP*TP*CP*GP*G)-3');MOLECULE: DNA (5'-D(P*GP*TP*CP*GP*G)-3');
4PHDDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.21 Å
Title : TEMPLATE BASE PAIRED WITH INCOMING NON-HYDROLYZABLE CTP AND MANGANESETEMPLATE BASE PAIRED WITH INCOMING NON-HYDROLYZABLE CTP AND MANGANESE
Classification : TRANSFERASE,LYASE/DNA
Molecule : DNA (5'-D(P*GP*TP*CP*GP*G)-3');MOLECULE: DNA (5'-D(P*GP*TP*CP*GP*G)-3');
4PHEDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.15 Å
Title : TEMPLATE BASE PAIRED WITH INCOMING NON-HYDROLYZABLE GTPTEMPLATE BASE PAIRED WITH INCOMING NON-HYDROLYZABLE GTP
Classification : TRANSFERASE,LYASE/DNA
Molecule : DNA (5'-D(P*GP*TP*CP*GP*G)-3');MOLECULE: DNA (5'-D(P*GP*TP*CP*GP*G)-3');
4PHPDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.60 Å
Title : TEMPLATE BASE PAIRED WITH INCOMING NON-HYDROLYZABLE GTP AND MANGANESETEMPLATE BASE PAIRED WITH INCOMING NON-HYDROLYZABLE GTP AND MANGANESE
Classification : TRANSFERASE,LYASE/DNA
Molecule : DNA POLYMERASE BETA;MOLECULE: DNA POLYMERASE BETA;
4PHTDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.83 Å
Title : VIBRIO VULNIFICUS TYPE II SECRETION SYSTEMVIBRIO VULNIFICUS TYPE II SECRETION SYSTEM
Classification : PROTEIN TRANSPORT
Molecule : GENERAL SECRETORY PATHWAY PROTEIN E;MOLECULE: GENERAL SECRETORY PATHWAY PROTEIN E;
4PIXDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.35 Å
Title : UNLIGANDED CYSTEINE DIOXYGENASE C93A VARIANT AT PH 6.2NLIGANDED CYSTEINE DIOXYGENASE C93A VARIANT AT PH 6.2
Classification : OXIDOREDUCTASE
Molecule : CYSTEINE DIOXYGENASE TYPE 1;MOLECULE: CYSTEINE DIOXYGENASE TYPE 1;
4PIYDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.60 Å
Title : HOMOCYSTEINE BOUND CYSTEINE DIOXYGENASE C93A VARIANT AT PH 6.2OMOCYSTEINE BOUND CYSTEINE DIOXYGENASE C93A VARIANT AT PH 6.2
Classification : OXIDOREDUCTASE
Molecule : CYSTEINE DIOXYGENASE TYPE 1;MOLECULE: CYSTEINE DIOXYGENASE TYPE 1;
4PIZDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.40 Å
Title : HOMOCYSTEINE-BOUND CYSTEINE DIOXYGENASE AT PH 6.2OMOCYSTEINE-BOUND CYSTEINE DIOXYGENASE AT PH 6.2
Classification : OXIDOREDUCTASE
Molecule : CYSTEINE DIOXYGENASE TYPE 1;MOLECULE: CYSTEINE DIOXYGENASE TYPE 1;
4PJYDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.50 Å
Title : AZIDE BOUND CYSTEINE DIOXYGENASE AT PH 6.2ZIDE BOUND CYSTEINE DIOXYGENASE AT PH 6.2
Classification : OXIDOREDUCTASE
Molecule : CYSTEINE DIOXYGENASE TYPE 1;MOLECULE: CYSTEINE DIOXYGENASE TYPE 1;
4PJZDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.87 Å
Title : TEICOPLANIN-A2-2TEICOPLANIN-A2-2
Classification : HYDROLASE/ANTIBIOTIC
Molecule : LYSOZYME;MOLECULE: LYSOZYME;
4PK0Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.30 Å
Title : A2-2A2-2
Classification : HYDROLASE/ANTIBIOTIC
Molecule : LYSOZYME;MOLECULE: LYSOZYME;
4PK2Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.35 Å
Title : TUBULIN ACETYLTRANSFERASE COMPLEX WITH BISUBSTRATE ANALOGUBULIN ACETYLTRANSFERASE COMPLEX WITH BISUBSTRATE ANALOG
Classification : TRANSFERASE/PEPTIDE
Molecule : ACETYL-SER-(N-PROPANOYL-LYS)-ASP--THR-NH2 PEPTIDE;MOLECULE: ACETYL-SER-(N-PROPANOYL-LYS)-ASP--THR-NH2 PEPTIDE;
4PK3Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.35 Å
Title : TUBULIN ACETYLTRANSFERASE COMPLEX WITH BISUBSTRATE ANALOGUBULIN ACETYLTRANSFERASE COMPLEX WITH BISUBSTRATE ANALOG
Classification : TRANSFERASE/PEPTIDE
Molecule : ACETYL-SER-ASP-(N-ACETYL-LYS)-THR-NH2 PEPTIDE;MOLECULE: ACETYL-SER-ASP-(N-ACETYL-LYS)-THR-NH2 PEPTIDE;
4PLXDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 3.10 Å
Title : END OF MALAT1END OF MALAT1
Classification : RNA
Molecule : CORE ENE HAIRPIN AND A-RICH TRACT FROM MALAT1;MOLECULE: CORE ENE HAIRPIN AND A-RICH TRACT FROM MALAT1;
4PMIDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 3.20 Å
Title : CRYSTAL STRUCTURE OF REV AND REV-RESPONSE-ELEMENT RNA COMPLEXRYSTAL STRUCTURE OF REV AND REV-RESPONSE-ELEMENT RNA COMPLEX
Classification : RNA BINDING PROTEIN/RNA
Molecule : PROTEIN REV;MOLECULE: PROTEIN REV;
4PMJDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.20 Å
Title : MELILOTI 1021 IN COMPLEX WITH NADPMELILOTI 1021 IN COMPLEX WITH NADP
Classification : OXIDOREDUCTASE
Molecule : PUTATIVE OXIDOREDUCTASE;MOLECULE: PUTATIVE OXIDOREDUCTASE;
4PMWDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.95 Å
Title : STRUCTURE OF MOUSE DIS3L2 IN COMPLEX WITH OLIGOU RNA SUBSTRATETRUCTURE OF MOUSE DIS3L2 IN COMPLEX WITH OLIGOU RNA SUBSTRATE
Classification : HYDROLASE/RNA
Molecule : U-U-U-U-U-U-U-U-U-U-U-U-U-U;MOLECULE: U-U-U-U-U-U-U-U-U-U-U-U-U-U;
4TKNDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 3.00 Å
Title : KRIT1KRIT1
Classification : PROTEIN TRANSPORT/SIGNALING PROTEIN
Molecule : KREV INTERACTION TRAPPED PROTEIN 1;MOLECULE: KREV INTERACTION TRAPPED PROTEIN 1;
4TN0Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.40 Å
Title : PHOSPHOETHANOLAMINE TRANSFERASE EPTC FROM CAMPYLOBACTER JEJUNIPHOSPHOETHANOLAMINE TRANSFERASE EPTC FROM CAMPYLOBACTER JEJUNI
Classification : TRANSFERASE
Molecule : UPF0141 PROTEIN YJDB;MOLECULE: UPF0141 PROTEIN YJDB;
4TN7Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.20 Å
Title : CRYSTAL STRUCTURE OF MOUSE KDM2A-H3K36ME-NO COMPLEXRYSTAL STRUCTURE OF MOUSE KDM2A-H3K36ME-NO COMPLEX
Classification : OXIDOREDUCTASE
Molecule : PEPTIDE;MOLECULE: PEPTIDE;
4TNMDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.90 Å
Title : DOMAINDOMAIN
Classification : PROTEIN BINDING
Molecule : IMPORTIN SUBUNIT ALPHA;MOLECULE: IMPORTIN SUBUNIT ALPHA;
4TO9Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.00 Å
Title : 2.0A RESOLUTION STRUCTURE OF BFRB (N148L) FROM PSEUDOMONAS AERUGINOSA.0A RESOLUTION STRUCTURE OF BFRB (N148L) FROM PSEUDOMONAS AERUGINOSA
Classification : OXIDOREDUCTASE
Molecule : BACTERIOFERRITIN;MOLECULE: BACTERIOFERRITIN;
4TOADeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.95 Å
Title : AERUGINOSAAERUGINOSA
Classification : OXIDOREDUCTASE
Molecule : BACTERIOFERRITIN;MOLECULE: BACTERIOFERRITIN;
4TOBDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.95 Å
Title : 1.95A RESOLUTION STRUCTURE OF BFRB (Q151L) FROM PSEUDOMONAS AERUGINOSA.95A RESOLUTION STRUCTURE OF BFRB (Q151L) FROM PSEUDOMONAS AERUGINOSA
Classification : OXIDOREDUCTASE
Molecule : BACTERIOFERRITIN;MOLECULE: BACTERIOFERRITIN;
4TOCDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.25 Å
Title : AERUGINOSAAERUGINOSA
Classification : OXIDOREDUCTASE
Molecule : BACTERIOFERRITIN;MOLECULE: BACTERIOFERRITIN;
4TODDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.05 Å
Title : 2.05A RESOLUTION STRUCTURE OF BFRB (D34F) FROM PSEUDOMONAS AERUGINOSA.05A RESOLUTION STRUCTURE OF BFRB (D34F) FROM PSEUDOMONAS AERUGINOSA
Classification : OXIDOREDUCTASE
Molecule : BACTERIOFERRITIN;MOLECULE: BACTERIOFERRITIN;
4TOEDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.20 Å
Title : AERUGINOSAAERUGINOSA
Classification : OXIDOREDUCTASE
Molecule : BACTERIOFERRITIN;MOLECULE: BACTERIOFERRITIN;
4TOFDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.65 Å
Title : PSEUDOMONAS AERUGINOSAPSEUDOMONAS AERUGINOSA
Classification : OXIDOREDUCTASE
Molecule : BACTERIOFERRITIN;MOLECULE: BACTERIOFERRITIN;
4TOGDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.80 Å
Title : PSEUDOMONAS AERUGINOSAPSEUDOMONAS AERUGINOSA
Classification : OXIDOREDUCTASE
Molecule : BACTERIOFERRITIN;MOLECULE: BACTERIOFERRITIN;
4TOHDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.80 Å
Title : PSEUDOMONAS AERUGINOSAPSEUDOMONAS AERUGINOSA
Classification : OXIDOREDUCTASE
Molecule : BACTERIOFERRITIN;MOLECULE: BACTERIOFERRITIN;
4TORDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.50 Å
Title : CRYSTAL STRUCTURE OF TANKYRASE 1 WITH IWR-8RYSTAL STRUCTURE OF TANKYRASE 1 WITH IWR-8
Classification : TRANSFERASE
Molecule : TANKYRASE-1;MOLECULE: TANKYRASE-1;
4TOSDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.80 Å
Title : CRYSTAL STRUCTURE OF TANKYRASE 1 WITH 355RYSTAL STRUCTURE OF TANKYRASE 1 WITH 355
Classification : TRANSFERASE
Molecule : TANKYRASE-1;MOLECULE: TANKYRASE-1;
4TPYDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.30 Å
Title : HIGH DENSITYHIGH DENSITY
Classification : HYDROLASE
Molecule : CATIONIC TRYPSIN;MOLECULE: CATIONIC TRYPSIN;
4TRJDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.73 Å
Title : CARBOXAMIDE, REFINED WITH NEW LIGAND RESTRAINTSCARBOXAMIDE, REFINED WITH NEW LIGAND RESTRAINTS
Classification : OXIDOREDUCTASE
Molecule : ENOYL-[ACYL-CARRIER-PROTEIN] REDUCTASE [NADH];MOLECULE: ENOYL-[ACYL-CARRIER-PROTEIN] REDUCTASE [NADH];
4TRKDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.75 Å
Title : STRUCTURE OF C. ELEGANS HIM-3TRUCTURE OF C. ELEGANS HIM-3
Classification : DNA BINDING PROTEIN
Molecule : C. ELEGANS HIM-3;MOLECULE: C. ELEGANS HIM-3;
4TSEDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.06 Å
Title : CRYSTAL STRUCTURE OF THE MIB REPEAT DOMAIN OF MIND BOMB 1RYSTAL STRUCTURE OF THE MIB REPEAT DOMAIN OF MIND BOMB 1
Classification : LIGASE
Molecule : E3 UBIQUITIN-PROTEIN LIGASE MIB1;MOLECULE: E3 UBIQUITIN-PROTEIN LIGASE MIB1;
4TT5Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.18 Å
Title : WITH 4-(4-BROMOPHENYL)-1H IMIDAZOLEWITH 4-(4-BROMOPHENYL)-1H IMIDAZOLE
Classification : OXIDOREDUCTASE
Molecule : CYTOCHROME P450 119;MOLECULE: CYTOCHROME P450 119;
4TTBDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.45 Å
Title : TO FMNTO FMN
Classification : OXIDOREDUCTASE
Molecule : IODOTYROSINE DEHALOGENASE 1;MOLECULE: IODOTYROSINE DEHALOGENASE 1;
4TTCDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.65 Å
Title : AND MONO-IODOTYROSINE (MIT)AND MONO-IODOTYROSINE (MIT)
Classification : OXIDOREDUCTASE
Molecule : IODOTYROSINE DEHALOGENASE 1;MOLECULE: IODOTYROSINE DEHALOGENASE 1;
4TU8Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.92 Å
Title : STRUCTURE OF U2AF65 VARIANT WITH BRU5A6 DNATRUCTURE OF U2AF65 VARIANT WITH BRU5A6 DNA
Classification : RNA BINDING PROTEIN/DNA
Molecule : DNA (5'-D(*UP*UP*UP*UP*(BRU)P*DA*U)-3');MOLECULE: DNA (5'-D(*UP*UP*UP*UP*(BRU)P*DA*U)-3');
4TU9Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.99 Å
Title : STRUCTURE OF U2AF65 VARIANT WITH BRU5G6 DNATRUCTURE OF U2AF65 VARIANT WITH BRU5G6 DNA
Classification : RNA BINDING PROTEIN/DNA
Molecule : DNA (5'-D(*UP*UP*UP*UP*(BRU)P*DG*U)-3');MOLECULE: DNA (5'-D(*UP*UP*UP*UP*(BRU)P*DG*U)-3');
4TUPDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.80 Å
Title : TEMPLATE (GG0B) IN A 1-NUCLEOTIDE GAPPED DNATEMPLATE (GG0B) IN A 1-NUCLEOTIDE GAPPED DNA
Classification : TRANSFERASE,LYASE/DNA
Molecule : DNA (5'-D(P*GP*TP*GP*GP*G)-3');MOLECULE: DNA (5'-D(P*GP*TP*GP*GP*G)-3');
4TUQDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.37 Å
Title : (GG0B).(GG0B).
Classification : TRANSFERASE,LYASE/DNA
Molecule : DNA (5'-D(P*GP*TP*GP*GP*G)-3');MOLECULE: DNA (5'-D(P*GP*TP*GP*GP*G)-3');
4TURDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.17 Å
Title : CISPLATIN CROSSLINKED GS (PT-GG2)CISPLATIN CROSSLINKED GS (PT-GG2)
Classification : TRANSFERASE,LYASE/DNA
Molecule : DNA (5'-D(P*GP*TP*GP*GP*G)-3');MOLECULE: DNA (5'-D(P*GP*TP*GP*GP*G)-3');
4TUSDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.42 Å
Title : CISPLATIN CROSSLINKED GS (PT-GG2) WITH MANGANESE IN THE ACTIVE SITE.CISPLATIN CROSSLINKED GS (PT-GG2) WITH MANGANESE IN THE ACTIVE SITE.
Classification : TRANSFERASE,LYASE/DNA
Molecule : DNA (5'-D(P*GP*TP*GP*GP*G)-3');MOLECULE: DNA (5'-D(P*GP*TP*GP*GP*G)-3');
4TUVDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.50 Å
Title : COMPLEXED WITH 4-(4-CHLOROPHENYL)IMIDAZOLECOMPLEXED WITH 4-(4-CHLOROPHENYL)IMIDAZOLE
Classification : OXIDOREDUCTASE
Molecule : CYTOCHROME P450 119;MOLECULE: CYTOCHROME P450 119;
4TUWDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.90 Å
Title : LOOP, PHOSPHO MIMIC OF TPNK AND C-TERMINAL REGIONLOOP, PHOSPHO MIMIC OF TPNK AND C-TERMINAL REGION
Classification : RNA BINDING PROTEIN/RNA
Molecule : HISTONE MRNA 3' STEM LOOP;MOLECULE: HISTONE MRNA 3' STEM LOOP;
4TUXDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 3.08 Å
Title : LOOPLOOP
Classification : RNA BINDING PROTEIN/RNA
Molecule : RNA (26-MER);MOLECULE: RNA (26-MER);
4TV0Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.60 Å
Title : LOOP, SELENOMETHIONINE DERIVATIVELOOP, SELENOMETHIONINE DERIVATIVE
Classification : RNA BINDING PROTEIN/RNA
Molecule : RNA (26-MER);MOLECULE: RNA (26-MER);
4TVQDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.80 Å
Title : CCM3 IN COMPLEX WITH CCM2 LD-LIKE MOTIFCM3 IN COMPLEX WITH CCM2 LD-LIKE MOTIF
Classification : PROTEIN BINDING
Molecule : CEREBRAL CAVERNOUS MALFORMATIONS 2 PROTEIN;MOLECULE: CEREBRAL CAVERNOUS MALFORMATIONS 2 PROTEIN;
4TVTDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.20 Å
Title : SCREENINGSCREENING
Classification : PLANT PROTEIN
Molecule : THAUMATIN-1;MOLECULE: THAUMATIN-1;
4TWRDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.90 Å
Title : STRUCTURE OF UDP-GLUCOSE 4-EPIMERASE FROM BRUCELLA ABORTUSTRUCTURE OF UDP-GLUCOSE 4-EPIMERASE FROM BRUCELLA ABORTUS
Classification : ISOMERASE
Molecule : NAD BINDING SITE:NAD-DEPENDENT EPIMERASE/DEHYDRATASE:UDP-MOLECULE: NAD BINDING SITE:NAD-DEPENDENT EPIMERASE/DEHYDRATASE:UDP-
4TX9Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.60 Å
Title : PROFARPROFAR
Classification : ISOMERASE
Molecule : PHOSPHORIBOSYL ISOMERASE A;MOLECULE: PHOSPHORIBOSYL ISOMERASE A;
4TZJDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.85 Å
Title : STRUCTURE OF C. ELEGANS HIM-3 BOUND TO HTP-3 CLOSURE MOTIF-4TRUCTURE OF C. ELEGANS HIM-3 BOUND TO HTP-3 CLOSURE MOTIF-4
Classification : PEPTIDE BINDING PROTEIN
Molecule : C. ELEGANS HIM-3 AND HTP-3;MOLECULE: C. ELEGANS HIM-3 AND HTP-3;
4TZKDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.62 Å
Title : 3-CARBOXAMIDE3-CARBOXAMIDE
Classification : OXIDOREDUCTASE
Molecule : ENOYL-[ACYL-CARRIER-PROTEIN] REDUCTASE [NADH];MOLECULE: ENOYL-[ACYL-CARRIER-PROTEIN] REDUCTASE [NADH];
4TZLDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.54 Å
Title : STRUCTURE OF C. ELEGANS HTP-2 BOUND TO HIM-3 CLOSURE MOTIF, P21 FORMTRUCTURE OF C. ELEGANS HTP-2 BOUND TO HIM-3 CLOSURE MOTIF, P21 FORM
Classification : PEPTIDE BINDING PROTEIN
Molecule : C. ELEGANS HIM-3 CLOSURE MOTIF;MOLECULE: C. ELEGANS HIM-3 CLOSURE MOTIF;
4TZMDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.30 Å
Title : C. ELEGANS HTP-2 BOUND TO HTP-3 CLOSURE MOTIF 1. ELEGANS HTP-2 BOUND TO HTP-3 CLOSURE MOTIF 1
Classification : PEPTIDE BINDING PROTEIN
Molecule : C. ELEGANS HTP-3 CLOSURE MOTIF1;MOLECULE: C. ELEGANS HTP-3 CLOSURE MOTIF1;
4TZNDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 3.12 Å
Title : STRUCTURE OF HTP-2 BOUND TO HTP-3 MOTIF-6TRUCTURE OF HTP-2 BOUND TO HTP-3 MOTIF-6
Classification : PEPTIDE BINDING PROTEIN
Molecule : PROTEIN HTP-3;MOLECULE: PROTEIN HTP-3;
4TZODeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.40 Å
Title : STRUCTURE OF C. ELEGANS HTP-1 BOUND TO HIM-3 CLOSURE MOTIFTRUCTURE OF C. ELEGANS HTP-1 BOUND TO HIM-3 CLOSURE MOTIF
Classification : PEPTIDE BINDING PROTEIN
Molecule : C. ELEGANS HIM-3 CLOSURE MOTIF;MOLECULE: C. ELEGANS HIM-3 CLOSURE MOTIF;
4TZQDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.30 Å
Title : STRUCTURE OF C. ELEGANS HTP-1 BOUND TO HTP-3 MOTIF-1TRUCTURE OF C. ELEGANS HTP-1 BOUND TO HTP-3 MOTIF-1
Classification : PEPTIDE BINDING PROTEIN
Molecule : PROTEIN HTP-3;MOLECULE: PROTEIN HTP-3;
4TZRDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.00 Å
Title : COMPLEX WITH INHIBITOR UW1561COMPLEX WITH INHIBITOR UW1561
Classification : TRANSFERASE
Molecule : CALMODULIN-DOMAIN PROTEIN KINASE 1;MOLECULE: CALMODULIN-DOMAIN PROTEIN KINASE 1;
4TZSDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.55 Å
Title : FORMFORM
Classification : PEPTIDE BINDING PROTEIN
Molecule : C. ELEGANS HIM-3 CLOSURE MOTIF;MOLECULE: C. ELEGANS HIM-3 CLOSURE MOTIF;
4TZTDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.86 Å
Title : OXOPYRROLIDINE-3-CARBOXAMIDEOXOPYRROLIDINE-3-CARBOXAMIDE
Classification : OXIDOREDUCTASE
Molecule : ENOYL-[ACYL-CARRIER-PROTEIN] REDUCTASE [NADH];MOLECULE: ENOYL-[ACYL-CARRIER-PROTEIN] REDUCTASE [NADH];
4U0JDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.62 Å
Title : REFINED WITH NEW LIGAND RESTRAINTSREFINED WITH NEW LIGAND RESTRAINTS
Classification : OXIDOREDUCTASE
Molecule : ENOYL-[ACYL-CARRIER-PROTEIN] REDUCTASE [NADH];MOLECULE: ENOYL-[ACYL-CARRIER-PROTEIN] REDUCTASE [NADH];
4U0KDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.90 Å
Title : OXOPYRROLIDINE-3-CARBOXAMIDEOXOPYRROLIDINE-3-CARBOXAMIDE
Classification : OXIDOREDUCTASE
Molecule : ENOYL-[ACYL-CARRIER-PROTEIN] REDUCTASE [NADH];MOLECULE: ENOYL-[ACYL-CARRIER-PROTEIN] REDUCTASE [NADH];
4U12Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.94 Å
Title : RESOLUTION: A KNOTTED HOMODIMERRESOLUTION: A KNOTTED HOMODIMER
Classification : STRUCTURAL GENOMICS, UNKNOWN FUNCTION
Molecule : UNCHARACTERIZED PROTEIN HP0242;MOLECULE: UNCHARACTERIZED PROTEIN HP0242;
4U13Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.30 Å
Title : FROM SINORHIZOBIUM MELILOTI AT 2.3 A RESOLUTIONFROM SINORHIZOBIUM MELILOTI AT 2.3 A RESOLUTION
Classification : TRANSFERASE
Molecule : PUTATIVE POLYKETIDE CYCLASE SMA1630;MOLECULE: PUTATIVE POLYKETIDE CYCLASE SMA1630;
4U21Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.39 Å
Title : GLUA2FLIP SLBD COMPLEXED WITH FW AND (R,R)-2B CRYSTAL FORM ELUA2FLIP SLBD COMPLEXED WITH FW AND (R,R)-2B CRYSTAL FORM E
Classification : TRANSPORT PROTEIN, MEMBRANE PROTEIN
Molecule : GLUTAMATE RECEPTOR 2,GLUTAMATE RECEPTOR 2;MOLECULE: GLUTAMATE RECEPTOR 2,GLUTAMATE RECEPTOR 2;
4U2YDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.48 Å
Title : SCO GLGEI-V279S IN COMPLEX WITH REACTION INTERMEDIATE AZASUGARCO GLGEI-V279S IN COMPLEX WITH REACTION INTERMEDIATE AZASUGAR
Classification : TRANSFERASE
Molecule : ALPHA-1,4-GLUCAN:MALTOSE-1-PHOSPHATE MALTOSYLTRANSFERASE 1;MOLECULE: ALPHA-1,4-GLUCAN:MALTOSE-1-PHOSPHATE MALTOSYLTRANSFERASE 1;
4U2ZDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.26 Å
Title : COMPLEXCOMPLEX
Classification : TRANSFERASE
Molecule : ALPHA-1,4-GLUCAN:MALTOSE-1-PHOSPHATE MALTOSYLTRANSFERASE 1;MOLECULE: ALPHA-1,4-GLUCAN:MALTOSE-1-PHOSPHATE MALTOSYLTRANSFERASE 1;
4U31Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.85 Å
Title : SCO GLGEI-V279S IN COMPLEX WITH MALTOSE-C-PHOSPHONATECO GLGEI-V279S IN COMPLEX WITH MALTOSE-C-PHOSPHONATE
Classification : TRANSFERASE
Molecule : ALPHA-1,4-GLUCAN:MALTOSE-1-PHOSPHATE MALTOSYLTRANSFERASE 1;MOLECULE: ALPHA-1,4-GLUCAN:MALTOSE-1-PHOSPHATE MALTOSYLTRANSFERASE 1;
4U33Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 3.29 Å
Title : STRUCTURE OF MTB GLGE BOUND TO MALTOSETRUCTURE OF MTB GLGE BOUND TO MALTOSE
Classification : TRANSFERASE
Molecule : ALPHA-1,4-GLUCAN:MALTOSE-1-PHOSPHATE MALTOSYLTRANSFERASE;MOLECULE: ALPHA-1,4-GLUCAN:MALTOSE-1-PHOSPHATE MALTOSYLTRANSFERASE;
4U3CDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 3.98 Å
Title : DOCKING SITE OF MALTOHEXAOSE IN THE MTB GLGEOCKING SITE OF MALTOHEXAOSE IN THE MTB GLGE
Classification : TRANSFERASE
Molecule : ALPHA-1,4-GLUCAN:MALTOSE-1-PHOSPHATE MALTOSYLTRANSFERASE;MOLECULE: ALPHA-1,4-GLUCAN:MALTOSE-1-PHOSPHATE MALTOSYLTRANSFERASE;
4U64Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.14 Å
Title : PNEUMOPHILA LAPD ORTHOLOG CDGS9 IN THE APO STATEPNEUMOPHILA LAPD ORTHOLOG CDGS9 IN THE APO STATE
Classification : TRANSFERASE
Molecule : TWO COMPONENT HISTIDINE KINASE, GGDEF DOMAIN PROTEIN/EALMOLECULE: TWO COMPONENT HISTIDINE KINASE, GGDEF DOMAIN PROTEIN/EAL
4U65Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.10 Å
Title : FLUORESCENS LAPGFLUORESCENS LAPG
Classification : TRANSFERASE/HYDROLASE
Molecule : PUTATIVE CYSTINE PROTEASE;MOLECULE: PUTATIVE CYSTINE PROTEASE;
4U7MDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.76 Å
Title : LRIG1 EXTRACELLULAR DOMAIN: STRUCTURE AND FUNCTION ANALYSISRIG1 EXTRACELLULAR DOMAIN: STRUCTURE AND FUNCTION ANALYSIS
Classification : SIGNALING PROTEIN
Molecule : LEUCINE-RICH REPEATS AND IMMUNOGLOBULIN-LIKE DOMAINSMOLECULE: LEUCINE-RICH REPEATS AND IMMUNOGLOBULIN-LIKE DOMAINS
4U8HDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.80 Å
Title : CRYSTAL STRUCTURE OF MAMMALIAN PERIOD-CRYPTOCHROME COMPLEXRYSTAL STRUCTURE OF MAMMALIAN PERIOD-CRYPTOCHROME COMPLEX
Classification : CIRCADIAN CLOCK PROTEIN/TRANSCRIPTION
Molecule : PERIOD CIRCADIAN PROTEIN HOMOLOG 2;MOLECULE: PERIOD CIRCADIAN PROTEIN HOMOLOG 2;
4U9PDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.70 Å
Title : FROM METHANOCALDOCOCCUS JANNASCHIIFROM METHANOCALDOCOCCUS JANNASCHII
Classification : UNKNOWN FUNCTION
Molecule : UPF0264 PROTEIN MJ1099;MOLECULE: UPF0264 PROTEIN MJ1099;
4UADDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.42 Å
Title : LOCALIZATION DOMAINLOCALIZATION DOMAIN
Classification : PROTEIN TRANSPORT
Molecule : POLYMERASE BASIC PROTEIN 2;MOLECULE: POLYMERASE BASIC PROTEIN 2;
4UAEDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.70 Å
Title : LOCALIZATION DOMAINLOCALIZATION DOMAIN
Classification : PROTEIN TRANSPORT
Molecule : POLYMERASE BASIC PROTEIN 2;MOLECULE: POLYMERASE BASIC PROTEIN 2;
4UAFDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.70 Å
Title : LOCALIZATION DOMAINLOCALIZATION DOMAIN
Classification : PROTEIN BINDING
Molecule : POLYMERASE BASIC PROTEIN 2;MOLECULE: POLYMERASE BASIC PROTEIN 2;
4UBEDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.93 Å
Title : FLURO ADENOSINEFLURO ADENOSINE
Classification : TRANSFERASE
Molecule : ADENOSINE KINASE;MOLECULE: ADENOSINE KINASE;
4W4VDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.01 Å
Title : PYRAZOL-1-YL)-N-(2-METHYLPYRIDIN-4-YL)BENZAMIDEPYRAZOL-1-YL)-N-(2-METHYLPYRIDIN-4-YL)BENZAMIDE
Classification : TRANSFERASE/TRANSFERASE INHIBITOR
Molecule : C-JUN N-TERMINAL KINASE 3;MOLECULE: C-JUN N-TERMINAL KINASE 3;
4W4WDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.90 Å
Title : [(PHENYLCARBAMOYL)AMINO]-1H-PYRAZOL-1-YL}BENZAMIDE[(PHENYLCARBAMOYL)AMINO]-1H-PYRAZOL-1-YL}BENZAMIDE
Classification : TRANSFERASE/TRANSFERASE INHIBITOR
Molecule : C-JUN N-TERMINAL KINASE 3;MOLECULE: C-JUN N-TERMINAL KINASE 3;
4W4XDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.65 Å
Title : PYRAZOL-1-YL)-N-(2-METHYLPYRIDIN-4-YL)BENZAMIDEPYRAZOL-1-YL)-N-(2-METHYLPYRIDIN-4-YL)BENZAMIDE
Classification : TRANSFERASE/TRANSFERASE INHIBITOR
Molecule : C-JUN NH2-TERMINAL KINASE 3;MOLECULE: C-JUN NH2-TERMINAL KINASE 3;
4W4YDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.30 Å
Title : PYRAZOL-1-YL)-N-(2-METHYLPYRIDIN-4-YL)BENZAMIDEPYRAZOL-1-YL)-N-(2-METHYLPYRIDIN-4-YL)BENZAMIDE
Classification : TRANSFERASE/TRANSFERASE INHIBITOR
Molecule : C-JUN NH2-TERMINAL KINASE 3;MOLECULE: C-JUN NH2-TERMINAL KINASE 3;
4W61Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.01 Å
Title : EUTROPHAEUTROPHA
Classification : TRANSFERASE
Molecule : BETA-KETOTHIOLASE BKTB;MOLECULE: BETA-KETOTHIOLASE BKTB;
4W6ZDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.40 Å
Title : ENZYMEENZYME
Classification : OXIDOREDUCTASE
Molecule : ALCOHOL DEHYDROGENASE 1;MOLECULE: ALCOHOL DEHYDROGENASE 1;
4W78Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.54 Å
Title : TUBERCULOSISTUBERCULOSIS
Classification : LYASE
Molecule : HYDRATASE CHSH2;MOLECULE: HYDRATASE CHSH2;
4W7SDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.54 Å
Title : ANGSTROMS RESOLUTIONANGSTROMS RESOLUTION
Classification : HYDROLASE
Molecule : PRE-MRNA-SPLICING ATP-DEPENDENT RNA HELICASE PRP28;MOLECULE: PRE-MRNA-SPLICING ATP-DEPENDENT RNA HELICASE PRP28;
4W8FDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 3.54 Å
Title : CRYSTAL STRUCTURE OF THE DYNEIN MOTOR DOMAIN IN THE AMPPNP-BOUND STATERYSTAL STRUCTURE OF THE DYNEIN MOTOR DOMAIN IN THE AMPPNP-BOUND STATE
Classification : MOTOR PROTEIN
Molecule : DYNEIN HEAVY CHAIN LYSOZYME CHIMERA;MOLECULE: DYNEIN HEAVY CHAIN LYSOZYME CHIMERA;
4W8QDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.43 Å
Title : ANGSTROMS RESOLUTIONANGSTROMS RESOLUTION
Classification : TOXIN
Molecule : HEMOLYSIN;MOLECULE: HEMOLYSIN;
4W8SDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.51 Å
Title : MIRABILIS AT 1.5 ANGSTROMS RESOLUTIONMIRABILIS AT 1.5 ANGSTROMS RESOLUTION
Classification : TOXIN
Molecule : HEMOLYSIN;MOLECULE: HEMOLYSIN;
4W8TDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.54 Å
Title : 1.5 ANGSTROMS RESOLUTION1.5 ANGSTROMS RESOLUTION
Classification : TOXIN
Molecule : HEMOLYSIN;MOLECULE: HEMOLYSIN;
4WALDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.20 Å
Title : AT 2.2 AAT 2.2 A
Classification : PROTEIN BINDING/RNA
Molecule : RNA (5'-R(P*UP*AP*CP*UP*AP*AP*CP*A)-3');MOLECULE: RNA (5'-R(P*UP*AP*CP*UP*AP*AP*CP*A)-3');
4WAMDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.20 Å
Title : H. INFLUENZAE BETA-CARBONIC ANHYDRASE VARIANT W39V/G41A/P48S/A49P. INFLUENZAE BETA-CARBONIC ANHYDRASE VARIANT W39V/G41A/P48S/A49P
Classification : LYASE
Molecule : BETA-CARBONIC ANHYDRASE;MOLECULE: BETA-CARBONIC ANHYDRASE;
4WANDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.80 Å
Title : CRYSTAL STRUCTURE OF MSL5 PROTEIN IN COMPLEX WITH RNA AT 1.8 ARYSTAL STRUCTURE OF MSL5 PROTEIN IN COMPLEX WITH RNA AT 1.8 A
Classification : PROTEIN BINDING/RNA
Molecule : RNA (5'-R(P*UP*AP*CP*UP*AP*AP*CP*A)-3');MOLECULE: RNA (5'-R(P*UP*AP*CP*UP*AP*AP*CP*A)-3');
4WBBDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.80 Å
Title : SINGLE TURNOVER AUTOPHOSPHORYLATION CYCLE OF THE PKA RIIB HOLOENZYMEINGLE TURNOVER AUTOPHOSPHORYLATION CYCLE OF THE PKA RIIB HOLOENZYME
Classification : TRANSFERASE
Molecule : CAMP-DEPENDENT PROTEIN KINASE CATALYTIC SUBUNIT ALPHA;MOLECULE: CAMP-DEPENDENT PROTEIN KINASE CATALYTIC SUBUNIT ALPHA;
4WD1Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.90 Å
Title : ACETOACETYL-COA SYNTHETASE FROM STREPTOMYCES LIVIDANSCETOACETYL-COA SYNTHETASE FROM STREPTOMYCES LIVIDANS
Classification : LIGASE
Molecule : ACETOACETATE-COA LIGASE;MOLECULE: ACETOACETATE-COA LIGASE;
4WHXDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.05 Å
Title : BURKHOLDERIA PSEUDOMALLEI BOUND TO THE CO-FACTOR PYRIDOXAL PHOSPHATEBURKHOLDERIA PSEUDOMALLEI BOUND TO THE CO-FACTOR PYRIDOXAL PHOSPHATE
Classification : TRANSFERASE
Molecule : BRANCHED-CHAIN-AMINO-ACID TRANSAMINASE;MOLECULE: BRANCHED-CHAIN-AMINO-ACID TRANSAMINASE;
4WIIDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.05 Å
Title : HUMAN SPLICING FACTOR, CONSTRUCT 3UMAN SPLICING FACTOR, CONSTRUCT 3
Classification : TRANSCRIPTION
Molecule : SPLICING FACTOR, PROLINE- AND GLUTAMINE-RICH;MOLECULE: SPLICING FACTOR, PROLINE- AND GLUTAMINE-RICH;
4WIJDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 3.49 Å
Title : HUMAN SPLICING FACTOR, CONSTRUCT 1UMAN SPLICING FACTOR, CONSTRUCT 1
Classification : TRANSCRIPTION
Molecule : SPLICING FACTOR, PROLINE- AND GLUTAMINE-RICH;MOLECULE: SPLICING FACTOR, PROLINE- AND GLUTAMINE-RICH;
4WIKDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 3.00 Å
Title : HUMAN SPLICING FACTOR, CONSTRUCT 2UMAN SPLICING FACTOR, CONSTRUCT 2
Classification : TRANSCRIPTION
Molecule : SPLICING FACTOR, PROLINE- AND GLUTAMINE-RICH;MOLECULE: SPLICING FACTOR, PROLINE- AND GLUTAMINE-RICH;
4WKBDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.37 Å
Title : IMMUCILLIN-AIMMUCILLIN-A
Classification : HYDROLASE/HYDROLASE INHIBITOR
Molecule : 5'-METHYLTHIOADENOSINE/S-ADENOSYLHOMOCYSTEINE NUCLEOSIDASE;MOLECULE: 5'-METHYLTHIOADENOSINE/S-ADENOSYLHOMOCYSTEINE NUCLEOSIDASE;
4WKCDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.64 Å
Title : DADME-IMMUCILLIN-ADADME-IMMUCILLIN-A
Classification : HYDROLASE/HYDROLASE INHIBITOR
Molecule : 5'-METHYLTHIOADENOSINE/S-ADENOSYLHOMOCYSTEINE NUCLEOSIDASE;MOLECULE: 5'-METHYLTHIOADENOSINE/S-ADENOSYLHOMOCYSTEINE NUCLEOSIDASE;
4WKNDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.00 Å
Title : DADME-IMMUCILLIN-ADADME-IMMUCILLIN-A
Classification : HYDROLASE/HYDROLASE INHIBITOR
Molecule : AMINODEOXYFUTALOSINE NUCLEOSIDASE;MOLECULE: AMINODEOXYFUTALOSINE NUCLEOSIDASE;
4WKODeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.90 Å
Title : HYDROXYBUTYLTHIO-DADME-IMMUCILLIN-AHYDROXYBUTYLTHIO-DADME-IMMUCILLIN-A
Classification : HYDROLASE/HYDROLASE INHIBITOR
Molecule : AMINODEOXYFUTALOSINE NUCLEOSIDASE;MOLECULE: AMINODEOXYFUTALOSINE NUCLEOSIDASE;
4WKPDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.58 Å
Title : HYDROXYETHOXY)ETHYLTHIOMETHYL-DADME-IMMUCILLIN-AHYDROXYETHOXY)ETHYLTHIOMETHYL-DADME-IMMUCILLIN-A
Classification : HYDROLASE/HYDROLASE INHIBITOR
Molecule : AMINODEOXYFUTALOSINE NUCLEOSIDASE;MOLECULE: AMINODEOXYFUTALOSINE NUCLEOSIDASE;
4WLPDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 3.10 Å
Title : CRYSTAL STRUCTURE OF UCH37-NFRKB INHIBITED DEUBIQUITYLATING COMPLEXRYSTAL STRUCTURE OF UCH37-NFRKB INHIBITED DEUBIQUITYLATING COMPLEX
Classification : PROTEIN BINDING
Molecule : NUCLEAR FACTOR RELATED TO KAPPA-B-BINDING PROTEIN;MOLECULE: NUCLEAR FACTOR RELATED TO KAPPA-B-BINDING PROTEIN;
4WLQDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.85 Å
Title : CRYSTAL STRUCTURE OF MUCH37-HRPN13 CTD COMPLEXRYSTAL STRUCTURE OF MUCH37-HRPN13 CTD COMPLEX
Classification : PROTEIN BINDING
Molecule : ,ARM-1,PROTEASOME REGULATORY PARTICLE NON-ATPASE 13,HRPN13,MOLECULE 1,ARM-1,PROTEASOME REGULATORY PARTICLE NON-ATPASE 13,HRPN13,
4WLRDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.00 Å
Title : CRYSTAL STRUCTURE OF MUCH37-HRPN13 CTD-HUB COMPLEXRYSTAL STRUCTURE OF MUCH37-HRPN13 CTD-HUB COMPLEX
Classification : PROTEIN BINDING
Molecule : POLYUBIQUITIN-B;MOLECULE: POLYUBIQUITIN-B;
4WLSDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.11 Å
Title : A COPPER EFFLUX REGULATOR, BOUND TO COPA PROMOTER DNAA COPPER EFFLUX REGULATOR, BOUND TO COPA PROMOTER DNA
Classification : TRANSCRIPTION REGULATOR/DNA
Molecule : COPA PROMOTER DNA NON-TEMPLATE STRAND (ALTERNATEMOLECULE: COPA PROMOTER DNA NON-TEMPLATE STRAND (ALTERNATE
4WLWDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.80 Å
Title : COPPER EFFLUX REGULATOR, BOUND TO COPA PROMOTER DNACOPPER EFFLUX REGULATOR, BOUND TO COPA PROMOTER DNA
Classification : TRANSCRIPTION/DNA
Molecule : DNA TEMPLATE STRAND (5-D(*DGP*DAP*DCP*DCP*DTPMOLECULE: DNA TEMPLATE STRAND (5-D(*DGP*DAP*DCP*DCP*DTP
4WM7Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.32 Å
Title : CRYSTAL STRUCTURE OF HUMAN ENTEROVIRUS D68 IN COMPLEX WITH PLECONARILRYSTAL STRUCTURE OF HUMAN ENTEROVIRUS D68 IN COMPLEX WITH PLECONARIL
Classification : VIRUS
Molecule : VP4;MOLECULE: VP4;
4WM8Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.00 Å
Title : CRYSTAL STRUCTURE OF HUMAN ENTEROVIRUS D68RYSTAL STRUCTURE OF HUMAN ENTEROVIRUS D68
Classification : VIRUS
Molecule : VP4;MOLECULE: VP4;
4WMZDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.05 Å
Title : S. CEREVISIAE CYP51 COMPLEXED WITH FLUCONAZOLE IN THE ACTIVE SITE. CEREVISIAE CYP51 COMPLEXED WITH FLUCONAZOLE IN THE ACTIVE SITE
Classification : OXIDOREDUCTASE/OXIDOREDUCATSE INHIBITOR
Molecule : LANOSTEROL 14-ALPHA DEMETHYLASE;MOLECULE: LANOSTEROL 14-ALPHA DEMETHYLASE;
4WNBDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.76 Å
Title : TUBERCULOSIS BOUND TO 3-OPC-COATUBERCULOSIS BOUND TO 3-OPC-COA
Classification : LYASE
Molecule : HYDRATASE CHSH1;MOLECULE: HYDRATASE CHSH1;
4WO6Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.00 Å
Title : LYSOZYME PRE-SURFACE ACOUSTIC WAVEYSOZYME PRE-SURFACE ACOUSTIC WAVE
Classification : HYDROLASE
Molecule : LYSOZYME C;MOLECULE: LYSOZYME C;
4WO9Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.99 Å
Title : LYSOZYME POST-SURFACE ACOUSTIC WAVESYSOZYME POST-SURFACE ACOUSTIC WAVES
Classification : HYDROLASE
Molecule : LYSOZYME C;MOLECULE: LYSOZYME C;
4WOADeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.80 Å
Title : LYSOZYME MULTIPLE CRYSTALS AFTER SURFACE ACOUSTIC WAVE ALIGNMENTYSOZYME MULTIPLE CRYSTALS AFTER SURFACE ACOUSTIC WAVE ALIGNMENT
Classification : HYDROLASE
Molecule : LYSOZYME C;MOLECULE: LYSOZYME C;
4WOBDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.90 Å
Title : PROTEINASE-K PRE-SURFACE ACOUSTIC WAVEROTEINASE-K PRE-SURFACE ACOUSTIC WAVE
Classification : HYDROLASE
Molecule : PROTEINASE K;MOLECULE: PROTEINASE K;
4WOCDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.60 Å
Title : PROTEINASE-K POST-SURFACE ACOUSTIC WAVESROTEINASE-K POST-SURFACE ACOUSTIC WAVES
Classification : HYDROLASE
Molecule : PROTEINASE K;MOLECULE: PROTEINASE K;
4WORDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.60 Å
Title : DIPHOSPHATE (PDTP) AT ROOM TEMPERATUREDIPHOSPHATE (PDTP) AT ROOM TEMPERATURE
Classification : HYDROLASE/HYDROLASE INHIBITOR
Molecule : THERMONUCLEASE;MOLECULE: THERMONUCLEASE;
4WPBDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 3.11 Å
Title : VASCULAR ENDOTHELIAL GROWTH FACTOR IN COMPLEX WITH ALPHA/BETA-VEGF-1ASCULAR ENDOTHELIAL GROWTH FACTOR IN COMPLEX WITH ALPHA/BETA-VEGF-1
Classification : PROTEIN BINDING
Molecule : ILS: THIS IS A SYNTHETIC DESIGNED MOLECULE BASED INITIALLYOTHER_DETAILS: THIS IS A SYNTHETIC DESIGNED MOLECULE BASED INITIALLY
4WPDDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.00 Å
Title : 1H-IMIDAZOLE1H-IMIDAZOLE
Classification : OXIDOREDUCTASE
Molecule : CYTOCHROME P450 119;MOLECULE: CYTOCHROME P450 119;
4WQJDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.70 Å
Title : AT 298K AND COMPLEXED WITH 4-(4-BROMOPHENYL)-1H IMIDAZOLEAT 298K AND COMPLEXED WITH 4-(4-BROMOPHENYL)-1H IMIDAZOLE
Classification : OXIDOREDUCTASE
Molecule : CYTOCHROME P450 119;MOLECULE: CYTOCHROME P450 119;
4WR9Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.30 Å
Title : (E171D/P175E/K203D)(E171D/P175E/K203D)
Classification : SUGAR BINDING PROTEIN
Molecule : PULMONARY SURFACTANT-ASSOCIATED PROTEIN A;MOLECULE: PULMONARY SURFACTANT-ASSOCIATED PROTEIN A;
4WRCDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.80 Å
Title : (E171D/P175E/R197N/K203D)(E171D/P175E/R197N/K203D)
Classification : SUGAR BINDING PROTEIN
Molecule : PULMONARY SURFACTANT-ASSOCIATED PROTEIN A;MOLECULE: PULMONARY SURFACTANT-ASSOCIATED PROTEIN A;
4WREDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.75 Å
Title : (E171D/P175E/R197N/K203D) COMPLEXED WITH INOSITOL(E171D/P175E/R197N/K203D) COMPLEXED WITH INOSITOL
Classification : SUGAR BINDING PROTEIN
Molecule : PULMONARY SURFACTANT-ASSOCIATED PROTEIN A;MOLECULE: PULMONARY SURFACTANT-ASSOCIATED PROTEIN A;
4WRFDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.90 Å
Title : (E171D/P175E/R197N/K203D) COMPLEXED WITH MANNOSE(E171D/P175E/R197N/K203D) COMPLEXED WITH MANNOSE
Classification : SUGAR BINDING PROTEIN
Molecule : PULMONARY SURFACTANT-ASSOCIATED PROTEIN A;MOLECULE: PULMONARY SURFACTANT-ASSOCIATED PROTEIN A;
4WSZDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.77 Å
Title : FAECALISFAECALIS
Classification : DNA BINDING PROTEIN
Molecule : RESPONSE REGULATOR RECEIVER DOMAIN PROTEIN;MOLECULE: RESPONSE REGULATOR RECEIVER DOMAIN PROTEIN;
4WT0Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.80 Å
Title : FAECALISFAECALIS
Classification : DNA BINDING PROTEIN
Molecule : RESPONSE REGULATOR RECEIVER DOMAIN PROTEIN;MOLECULE: RESPONSE REGULATOR RECEIVER DOMAIN PROTEIN;
4WU4Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.30 Å
Title : COMPLEXED WITH 22BP DNACOMPLEXED WITH 22BP DNA
Classification : DNA BINDING PROTEIN/DNA
Molecule : DNA (5'-MOLECULE: DNA (5'-
4WUHDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.29 Å
Title : COMPLEXED WITH 22BP DNACOMPLEXED WITH 22BP DNA
Classification : DNA BINDING PROTEIN/DNA
Molecule : DNA (5'-D(P*AP*AP*AP*TP*CP*G)-3');MOLECULE: DNA (5'-D(P*AP*AP*AP*TP*CP*G)-3');
4WUIDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.09 Å
Title : CRYSTAL STRUCTURE OF TRPF FROM JONESIA DENITRIFICANSRYSTAL STRUCTURE OF TRPF FROM JONESIA DENITRIFICANS
Classification : ISOMERASE
Molecule : N-(5'-PHOSPHORIBOSYL)ANTHRANILATE ISOMERASE;MOLECULE: N-(5'-PHOSPHORIBOSYL)ANTHRANILATE ISOMERASE;
4WULDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.40 Å
Title : COMPLEXED WITH 26BP DNACOMPLEXED WITH 26BP DNA
Classification : DNA BINDING PROTEIN/DNA
Molecule : DNA (26-MER);MOLECULE: DNA (26-MER);
4WUWDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.40 Å
Title : (E171D/P175E/K203D) COMPLEXED WITH INOSITOL(E171D/P175E/K203D) COMPLEXED WITH INOSITOL
Classification : SUGAR BINDING PROTEIN
Molecule : PULMONARY SURFACTANT-ASSOCIATED PROTEIN A;MOLECULE: PULMONARY SURFACTANT-ASSOCIATED PROTEIN A;
4WUXDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.90 Å
Title : (E171D/P175E/K203D) COMPLEXED WITH MANNOSE(E171D/P175E/K203D) COMPLEXED WITH MANNOSE
Classification : SUGAR BINDING PROTEIN
Molecule : PULMONARY SURFACTANT-ASSOCIATED PROTEIN A;MOLECULE: PULMONARY SURFACTANT-ASSOCIATED PROTEIN A;
4WV3Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.60 Å
Title : WITH ANTHRANOYL-AMPWITH ANTHRANOYL-AMP
Classification : LIGASE/LIGASE INHIBITOR
Molecule : ANTHRANILATE-COA LIGASE;MOLECULE: ANTHRANILATE-COA LIGASE;
4WV9Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.00 Å
Title : AZONIABICYCLO[3.2.1]OCTANEAZONIABICYCLO[3.2.1]OCTANE
Classification : CHOLINE-BINDING PROTEIN
Molecule : SOLUBLE ACETYLCHOLINE RECEPTOR;MOLECULE: SOLUBLE ACETYLCHOLINE RECEPTOR;
4WVHDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.10 Å
Title : AUREUS (SPSB) IN COMPLEX WITH A SUBSTRATE PEPTIDE (PEP1).AUREUS (SPSB) IN COMPLEX WITH A SUBSTRATE PEPTIDE (PEP1).
Classification : SIGNALING PROTEIN
Molecule : SUBSTRATE PEPTIDE (PEP1);MOLECULE: SUBSTRATE PEPTIDE (PEP1);
4WVIDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.90 Å
Title : AUREUS (SPSB) IN COMPLEX WITH A SUBSTRATE PEPTIDE (PEP2).AUREUS (SPSB) IN COMPLEX WITH A SUBSTRATE PEPTIDE (PEP2).
Classification : HYDROLASE
Molecule : SUBSTRATE PEPTIDE (PEP2);MOLECULE: SUBSTRATE PEPTIDE (PEP2);
4WWKDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 3.10 Å
Title : 5, ANTIGEN-PRESENTING MOLECULE CD1D, AND BETA-2-MICROGLOBULIN5, ANTIGEN-PRESENTING MOLECULE CD1D, AND BETA-2-MICROGLOBULIN
Classification : IMMUNE SYSTEM
Molecule : BETA-2-MICROGLOBULIN;MOLECULE: BETA-2-MICROGLOBULIN;
4WY2Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.80 Å
Title : GLUCOSAMINEGLUCOSAMINE
Classification : STRUCTURAL GENOMICS, UNKNOWN FUNCTION
Molecule : UNIVERSAL STRESS PROTEIN E;MOLECULE: UNIVERSAL STRESS PROTEIN E;
4WY4Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.40 Å
Title : CRYSTAL STRUCTURE OF AUTOPHAGIC SNARE COMPLEXRYSTAL STRUCTURE OF AUTOPHAGIC SNARE COMPLEX
Classification : MEMBRANE PROTEIN
Molecule : SYNAPTOSOMAL-ASSOCIATED PROTEIN 29;MOLECULE: SYNAPTOSOMAL-ASSOCIATED PROTEIN 29;
4WYNDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.81 Å
Title : THE CRYSTAL STRUCTURE OF THE A109G MUTANT OF RNASE AHE CRYSTAL STRUCTURE OF THE A109G MUTANT OF RNASE A
Classification : HYDROLASE
Molecule : RIBONUCLEASE PANCREATIC;MOLECULE: RIBONUCLEASE PANCREATIC;
4WYPDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.50 Å
Title : 5'AMP5'AMP
Classification : HYDROLASE
Molecule : RIBONUCLEASE PANCREATIC;MOLECULE: RIBONUCLEASE PANCREATIC;
4WYZDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.45 Å
Title : 3'UMP3'UMP
Classification : HYDROLASE
Molecule : RIBONUCLEASE PANCREATIC;MOLECULE: RIBONUCLEASE PANCREATIC;
4WZ0Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.95 Å
Title : PNEUMOPHILA STR. PARISPNEUMOPHILA STR. PARIS
Classification : LIGASE
Molecule : E3 UBIQUITIN-PROTEIN LIGASE LUBX;MOLECULE: E3 UBIQUITIN-PROTEIN LIGASE LUBX;
4WZ2Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 3.41 Å
Title : PNEUMOPHILA STR. PARIS, ILE175MET MUTANTPNEUMOPHILA STR. PARIS, ILE175MET MUTANT
Classification : LIGASE
Molecule : E3 UBIQUITIN-PROTEIN LIGASE LUBX;MOLECULE: E3 UBIQUITIN-PROTEIN LIGASE LUBX;
4WZ3Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.70 Å
Title : AND HOMO SAPIENS UBE2D2AND HOMO SAPIENS UBE2D2
Classification : LIGASE
Molecule : E3 UBIQUITIN-PROTEIN LIGASE LUBX;MOLECULE: E3 UBIQUITIN-PROTEIN LIGASE LUBX;
4X0ODeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.20 Å
Title : VIBRIO CHOLERAE SOAKED WITH ACETYL-COAVIBRIO CHOLERAE SOAKED WITH ACETYL-COA
Classification : TRANSFERASE
Molecule : 3-OXOACYL-[ACYL-CARRIER-PROTEIN] SYNTHASE 3 PROTEIN 2;MOLECULE: 3-OXOACYL-[ACYL-CARRIER-PROTEIN] SYNTHASE 3 PROTEIN 2;
4X1JDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.50 Å
Title : X-RAY CRYSTAL STRUCTURE OF THE DIMERIC BMP ANTAGONIST NBL1-RAY CRYSTAL STRUCTURE OF THE DIMERIC BMP ANTAGONIST NBL1
Classification : BMP BINDING PROTEIN
Molecule : NEUROBLASTOMA SUPPRESSOR OF TUMORIGENICITY 1;MOLECULE: NEUROBLASTOMA SUPPRESSOR OF TUMORIGENICITY 1;
4X24Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.50 Å
Title : IMMUCILLIN-AIMMUCILLIN-A
Classification : HYDROLASE/HYDROLASE INHIBITOR
Molecule : 5'-METHYLTHIOADENOSINE/S-ADENOSYLHOMOCYSTEINE NUCLEOSIDASE;MOLECULE: 5'-METHYLTHIOADENOSINE/S-ADENOSYLHOMOCYSTEINE NUCLEOSIDASE;
4X28Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.99 Å
Title : TUBERCULOSISTUBERCULOSIS
Classification : OXIDOREDUCTASE
Molecule : ACYL-COA DEHYDROGENASE;MOLECULE: ACYL-COA DEHYDROGENASE;
4X2QDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.94 Å
Title : CRYSTAL STRUCTURE OF HUMAN ALDEHYDE DEHYDROGENASE, ALDH1A2RYSTAL STRUCTURE OF HUMAN ALDEHYDE DEHYDROGENASE, ALDH1A2
Classification : OXIDOREDUCTASE
Molecule : RETINAL DEHYDROGENASE 2;MOLECULE: RETINAL DEHYDROGENASE 2;
4X2RDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.05 Å
Title : CRYSTAL STRUCTURE OF PRIA FROM ACTINOMYCES UROGENITALISRYSTAL STRUCTURE OF PRIA FROM ACTINOMYCES UROGENITALIS
Classification : ISOMERASE
Molecule : 1-(5-PHOSPHORIBOSYL)-5-[(5-PHOSPHORIBOSYLAMINO)MOLECULE: 1-(5-PHOSPHORIBOSYL)-5-[(5-PHOSPHORIBOSYLAMINO)
4X2TDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.73 Å
Title : FALCIPARUMFALCIPARUM
Classification : HYDROLASE/HYDROLASE INHIBITOR
Molecule : M17 LEUCYL AMINOPEPTIDASE;MOLECULE: M17 LEUCYL AMINOPEPTIDASE;
4X2UDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.50 Å
Title : FALCIPARUMFALCIPARUM
Classification : HYDROLASE/HYDROLASE INHIBITOR
Molecule : M1 FAMILY AMINOPEPTIDASE;MOLECULE: M1 FAMILY AMINOPEPTIDASE;
4X4JDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.65 Å
Title : DURING BE-7585A BIOSYNTHESISDURING BE-7585A BIOSYNTHESIS
Classification : OXIDOREDUCTASE
Molecule : PUTATIVE OXYGENASE;MOLECULE: PUTATIVE OXYGENASE;
4X67Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 4.10 Å
Title : OXIDATIVE CYCLOPURINE DNA LESIONS.OXIDATIVE CYCLOPURINE DNA LESIONS.
Classification : TRANSCRIPTION/DNA
Molecule : TEMPLATE DNA _29 MER;MOLECULE: TEMPLATE DNA _29 MER;
4X6ADeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 3.96 Å
Title : CYCLOPURINE DNA LESIONSCYCLOPURINE DNA LESIONS
Classification : TRANSCRIPTION/DNA
Molecule : TEMPLATE DNA _29 MER;MOLECULE: TEMPLATE DNA _29 MER;
4X6QDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.52 Å
Title : TO MEMBRANESTO MEMBRANES
Classification : TRANSFERASE
Molecule : CAMP-DEPENDENT PROTEIN KINASE CATALYTIC SUBUNIT ALPHA;MOLECULE: CAMP-DEPENDENT PROTEIN KINASE CATALYTIC SUBUNIT ALPHA;
4X6RDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.40 Å
Title : TO MEMBRANESTO MEMBRANES
Classification : TRANSFERASE
Molecule : CAMP-DEPENDENT PROTEIN KINASE TYPE I-ALPHA REGULATORYMOLECULE: CAMP-DEPENDENT PROTEIN KINASE TYPE I-ALPHA REGULATORY
4X7WDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.75 Å
Title : COMPLEX WITH MG, SAH AND MYCINAMICIN VI (MYCE SUBSTRATE)COMPLEX WITH MG, SAH AND MYCINAMICIN VI (MYCE SUBSTRATE)
Classification : TRANSFERASE/ANTIOBIOTIC
Molecule : MYCINAMICIN III 3''-O-METHYLTRANSFERASE;MOLECULE: MYCINAMICIN III 3''-O-METHYLTRANSFERASE;
4X9KDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.61 Å
Title : VIBRIO CHOLERAEVIBRIO CHOLERAE
Classification : TRANSFERASE
Molecule : 3-OXOACYL-[ACYL-CARRIER-PROTEIN] SYNTHASE 3 PROTEIN 2;MOLECULE: 3-OXOACYL-[ACYL-CARRIER-PROTEIN] SYNTHASE 3 PROTEIN 2;
4X9ODeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.30 Å
Title : BOUND SUBSTRATEBOUND SUBSTRATE
Classification : TRANSFERASE
Molecule : 3-OXOACYL-[ACYL-CARRIER-PROTEIN] SYNTHASE 3 PROTEIN 2;MOLECULE: 3-OXOACYL-[ACYL-CARRIER-PROTEIN] SYNTHASE 3 PROTEIN 2;
4X9RDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.40 Å
Title : PHOSPHOPEPTIDE MACROCYCLE 3BPHOSPHOPEPTIDE MACROCYCLE 3B
Classification : TRANSFERASE/TRANSFERASE INHIBITOR
Molecule : PHOSPHOPEPTIDE MACROCYCLE 3B;MOLECULE: PHOSPHOPEPTIDE MACROCYCLE 3B;
4X9XDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.20 Å
Title : BINDING PROTEIN FAMILYBINDING PROTEIN FAMILY
Classification : TRANSFERASE
Molecule : DEGV DOMAIN-CONTAINING PROTEIN MW1315;MOLECULE: DEGV DOMAIN-CONTAINING PROTEIN MW1315;
4XA8Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.90 Å
Title : FROM XANTHOBACTER AUTOTROPHICUS PY2FROM XANTHOBACTER AUTOTROPHICUS PY2
Classification : OXIDOREDUCTASE
Molecule : D-ISOMER SPECIFIC 2-HYDROXYACID DEHYDROGENASE NAD-BINDING;MOLECULE: D-ISOMER SPECIFIC 2-HYDROXYACID DEHYDROGENASE NAD-BINDING;
4XA9Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.00 Å
Title : AND LEGL1 FROM LEGIONELLA PNEUMOPHILA STR. PHILADELPHIAAND LEGL1 FROM LEGIONELLA PNEUMOPHILA STR. PHILADELPHIA
Classification : STRUCTURAL GENOMICS, UNKNOWN FUNCTION
Molecule : UNCHARACTERIZED PROTEIN;MOLECULE: UNCHARACTERIZED PROTEIN;
4XBHDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.11 Å
Title : SOLUBLE RABBIT NEPRILYSINOLUBLE RABBIT NEPRILYSIN
Classification : HYDROLASE
Molecule : NEPRILYSIN;MOLECULE: NEPRILYSIN;
4XDIDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.89 Å
Title : STRUCTURE OF CHLAMYDOMONAS REINHARDTII THB1TRUCTURE OF CHLAMYDOMONAS REINHARDTII THB1
Classification : HEME BINDING PROTEIN
Molecule : CHLAMYDOMONAS REINHARDTII THB1;MOLECULE: CHLAMYDOMONAS REINHARDTII THB1;
4XE6Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.69 Å
Title : YL]PYRIMIDINE-2,4-DIAMINE (UCP1061)YL]PYRIMIDINE-2,4-DIAMINE (UCP1061)
Classification : OXIDOREDUCTASE/OXIDOREDUCTASE INHIBITOR
Molecule : DIHYDROFOLATE REDUCTASE;MOLECULE: DIHYDROFOLATE REDUCTASE;
4XEADeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.95 Å
Title : ACIDOCALDARIUSACIDOCALDARIUS
Classification : HYDROLASE
Molecule : PEPTIDASE M16 DOMAIN PROTEIN;MOLECULE: PEPTIDASE M16 DOMAIN PROTEIN;
4XECDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.69 Å
Title : YL]PYRIMIDINE-2,4-DIAMINE (UCP1061)YL]PYRIMIDINE-2,4-DIAMINE (UCP1061)
Classification : OXIDOREDUCTASE/OXIDOREDUCTASE INHIBITOR
Molecule : DIHYDROFOLATE REDUCTASE;MOLECULE: DIHYDROFOLATE REDUCTASE;
4XEDDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.23 Å
Title : AB-540-F20AB-540-F20
Classification : PROTEIN BINDING
Molecule : PEPTIDASE M14, CARBOXYPEPTIDASE A;MOLECULE: PEPTIDASE M14, CARBOXYPEPTIDASE A;
4XF9Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.30 Å
Title : HOMOCYSTEINEHOMOCYSTEINE
Classification : OXIDOREDUCTASE
Molecule : CYSTEINE DIOXYGENASE TYPE 1;MOLECULE: CYSTEINE DIOXYGENASE TYPE 1;
4XFADeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.65 Å
Title : HOMOCYSTEINEHOMOCYSTEINE
Classification : OXIDOREDUCTASE
Molecule : CYSTEINE DIOXYGENASE TYPE 1;MOLECULE: CYSTEINE DIOXYGENASE TYPE 1;
4XFBDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.35 Å
Title : CYSTEINE DIOXYGENASE VARIANT - C93A AT PH 8.0 UNLIGANDEDYSTEINE DIOXYGENASE VARIANT - C93A AT PH 8.0 UNLIGANDED
Classification : OXIDOREDUCTASE
Molecule : CYSTEINE DIOXYGENASE TYPE 1;MOLECULE: CYSTEINE DIOXYGENASE TYPE 1;
4XFCDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.35 Å
Title : CYSTEINE DIOXYGENASE VARIANT - Y157F AT PH 6.2 UNLIGANDEDYSTEINE DIOXYGENASE VARIANT - Y157F AT PH 6.2 UNLIGANDED
Classification : OXIDOREDUCTASE
Molecule : CYSTEINE DIOXYGENASE TYPE 1;MOLECULE: CYSTEINE DIOXYGENASE TYPE 1;
4XFFDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.25 Å
Title : CYSTEINE DIOXYGENASE VARIANT - Y157F AT PH 6.2 WITH DITHIONITEYSTEINE DIOXYGENASE VARIANT - Y157F AT PH 6.2 WITH DITHIONITE
Classification : OXIDOREDUCTASE
Molecule : CYSTEINE DIOXYGENASE TYPE 1;MOLECULE: CYSTEINE DIOXYGENASE TYPE 1;
4XFGDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.40 Å
Title : CYSTEINE DIOXYGENASE VARIANT - C93A AT PH 6.2 WITH CYSTEINEYSTEINE DIOXYGENASE VARIANT - C93A AT PH 6.2 WITH CYSTEINE
Classification : OXIDOREDUCTASE
Molecule : CYSTEINE DIOXYGENASE TYPE 1;MOLECULE: CYSTEINE DIOXYGENASE TYPE 1;
4XFHDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.35 Å
Title : CYSTEINE DIOXYGENASE VARIANT - Y157F AT PH 6.2 WITH CYSTEINEYSTEINE DIOXYGENASE VARIANT - Y157F AT PH 6.2 WITH CYSTEINE
Classification : OXIDOREDUCTASE
Molecule : CYSTEINE DIOXYGENASE TYPE 1;MOLECULE: CYSTEINE DIOXYGENASE TYPE 1;
4XFIDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.40 Å
Title : CYSTEINE DIOXYGENASE VARIANT - Y157F AT PH 6.2 WITH HOMOCYSTEINEYSTEINE DIOXYGENASE VARIANT - Y157F AT PH 6.2 WITH HOMOCYSTEINE
Classification : OXIDOREDUCTASE
Molecule : CYSTEINE DIOXYGENASE TYPE 1;MOLECULE: CYSTEINE DIOXYGENASE TYPE 1;
4XFSDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.91 Å
Title : STRUCTURE OF IL-18 SER MUTANT ITRUCTURE OF IL-18 SER MUTANT I
Classification : CYTOKINE
Molecule : INTERLEUKIN-18;MOLECULE: INTERLEUKIN-18;
4XFTDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.00 Å
Title : STRUCTURE OF IL-18 SER MUTANT IIITRUCTURE OF IL-18 SER MUTANT III
Classification : CYTOKINE
Molecule : INTERLEUKIN-18;MOLECULE: INTERLEUKIN-18;
4XFUDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.85 Å
Title : STRUCTURE OF IL-18 SER MUTANT VTRUCTURE OF IL-18 SER MUTANT V
Classification : CYTOKINE
Molecule : INTERLEUKIN-18;MOLECULE: INTERLEUKIN-18;
4XFXDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.43 Å
Title : STRUCTURE OF THE NATIVE FULL-LENGTH HIV-1 CAPSID PROTEINTRUCTURE OF THE NATIVE FULL-LENGTH HIV-1 CAPSID PROTEIN
Classification : VIRAL PROTEIN
Molecule : HIV-1 CAPSID PROTEIN;MOLECULE: HIV-1 CAPSID PROTEIN;
4XFYDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.80 Å
Title : STRUCTURE OF THE NATIVE FULL-LENGTH DEHYDRATED HIV-1 CAPSID PROTEINTRUCTURE OF THE NATIVE FULL-LENGTH DEHYDRATED HIV-1 CAPSID PROTEIN
Classification : VIRAL PROTEIN
Molecule : HIV-1 CAPSID PROTEIN;MOLECULE: HIV-1 CAPSID PROTEIN;
4XFZDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.70 Å
Title : WITH PF-3450074 (PF74)WITH PF-3450074 (PF74)
Classification : VIRAL PROTEIN
Molecule : HIV-1 CAPSID PROTEIN;MOLECULE: HIV-1 CAPSID PROTEIN;
4XGCDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 3.50 Å
Title : CRYSTAL STRUCTURE OF THE EUKARYOTIC ORIGIN RECOGNITION COMPLEXRYSTAL STRUCTURE OF THE EUKARYOTIC ORIGIN RECOGNITION COMPLEX
Classification : DNA BINDING PROTEIN
Molecule : ORIGIN RECOGNITION COMPLEX SUBUNIT 4;MOLECULE: ORIGIN RECOGNITION COMPLEX SUBUNIT 4;
4XGUDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.30 Å
Title : STRUCTURE OF C. ELEGANS PCH-2TRUCTURE OF C. ELEGANS PCH-2
Classification : ATP-BINDING PROTEIN
Molecule : PUTATIVE PACHYTENE CHECKPOINT PROTEIN 2;MOLECULE: PUTATIVE PACHYTENE CHECKPOINT PROTEIN 2;
4XI6Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.04 Å
Title : CRYSTAL STRUCTURE OF THE MZM-REP DOMAINS OF MIND BOMB 1RYSTAL STRUCTURE OF THE MZM-REP DOMAINS OF MIND BOMB 1
Classification : LIGASE
Molecule : E3 UBIQUITIN-PROTEIN LIGASE MIB1;MOLECULE: E3 UBIQUITIN-PROTEIN LIGASE MIB1;
4XI7Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.05 Å
Title : WITH JAGGED1 N-BOX PEPTIDEWITH JAGGED1 N-BOX PEPTIDE
Classification : LIGASE
Molecule : JAGGED 1 N-BOX PEPTIDE;MOLECULE: JAGGED 1 N-BOX PEPTIDE;
4XIBDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.15 Å
Title : WITH FLY DELTA N-BOX PEPTIDEWITH FLY DELTA N-BOX PEPTIDE
Classification : LIGASE
Molecule : DELTA N-BOX PEPTIDE;MOLECULE: DELTA N-BOX PEPTIDE;
4XJVDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.80 Å
Title : CRYSTAL STRUCTURE OF HUMAN THIOESTERASE 2RYSTAL STRUCTURE OF HUMAN THIOESTERASE 2
Classification : HYDROLASE
Molecule : S-ACYL FATTY ACID SYNTHASE THIOESTERASE, MEDIUM CHAIN;MOLECULE: S-ACYL FATTY ACID SYNTHASE THIOESTERASE, MEDIUM CHAIN;
4XK2Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.90 Å
Title : CRYSTAL STRUCTURE OF ALDO-KETO REDUCTASE FROM POLAROMONAS SP. JS666RYSTAL STRUCTURE OF ALDO-KETO REDUCTASE FROM POLAROMONAS SP. JS666
Classification : OXIDOREDUCTASE
Molecule : ALDO/KETO REDUCTASE;MOLECULE: ALDO/KETO REDUCTASE;
4XL1Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.30 Å
Title : COMPLEX OF NOTCH1 (EGF11-13) BOUND TO DELTA-LIKE 4 (N-EGF1)OMPLEX OF NOTCH1 (EGF11-13) BOUND TO DELTA-LIKE 4 (N-EGF1)
Classification : PROTEIN BINDING
Molecule : DELTA-LIKE PROTEIN;MOLECULE: DELTA-LIKE PROTEIN;
4XLNDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 4.00 Å
Title : CONTAINING BUBBLE PROMOTER AND RNACONTAINING BUBBLE PROMOTER AND RNA
Classification : TRANSCRIPTION/DNA/RNA
Molecule : RNA (5'-D(P*UP*CP*GP*A)-3');MOLECULE: RNA (5'-D(P*UP*CP*GP*A)-3');
4XLPDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 4.00 Å
Title : CONTAINING UPSTREAM FORK PROMOTERCONTAINING UPSTREAM FORK PROMOTER
Classification : TRANSCRIPTION/DNA
Molecule : DNA (25-MER);MOLECULE: DNA (25-MER);
4XLQDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 4.60 Å
Title : CONTAINING UPSTREAM FORK (-11 BASE-PAIRED) PROMOTERCONTAINING UPSTREAM FORK (-11 BASE-PAIRED) PROMOTER
Classification : TRANSCRIPTION/DNA
Molecule : DNA (26-MER);MOLECULE: DNA (26-MER);
4XLVDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.30 Å
Title : DIMERDIMER
Classification : TRANSFERASE
Molecule : INSULIN RECEPTOR;MOLECULE: INSULIN RECEPTOR;
4XLWDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 3.39 Å
Title : COMPLEX OF NOTCH1 (EGF11-13) BOUND TO DELTA-LIKE 4 (N-EGF2)OMPLEX OF NOTCH1 (EGF11-13) BOUND TO DELTA-LIKE 4 (N-EGF2)
Classification : PROTEIN BINDING
Molecule : DELTA-LIKE PROTEIN;MOLECULE: DELTA-LIKE PROTEIN;
4XMKDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 3.18 Å
Title : ANTIBODY 2424 IN COMPLEX WITH JR-FL V3 PEPTIDEANTIBODY 2424 IN COMPLEX WITH JR-FL V3 PEPTIDE
Classification : IMMUNE SYSTEM/VIRAL PROTEIN
Molecule : HIV-1 JR-FL GP120 V3 PEPTIDE;MOLECULE: HIV-1 JR-FL GP120 V3 PEPTIDE;
4XMLDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.68 Å
Title : ANTIBODY 2424ANTIBODY 2424
Classification : IMMUNE SYSTEM
Molecule : HEAVY CHAIN OF HIV-1 GP120 V3-SPECIFIC HUMAN MONOCLONALMOLECULE: HEAVY CHAIN OF HIV-1 GP120 V3-SPECIFIC HUMAN MONOCLONAL
4XMMDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 7.38 Å
Title : STRUCTURE OF THE YEAST COAT NUCLEOPORIN COMPLEX, SPACE GROUP C2TRUCTURE OF THE YEAST COAT NUCLEOPORIN COMPLEX, SPACE GROUP C2
Classification : TRANSPORT PROTEIN/IMMUNE SYSTEM
Molecule : ANTIBODY 57 LIGHT CHAIN;MOLECULE: ANTIBODY 57 LIGHT CHAIN;
4XNODeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.99 Å
Title : CRYSTAL STRUCTURE OF 5'-CTTATPPPZZZATAAGRYSTAL STRUCTURE OF 5'-CTTATPPPZZZATAAG
Classification : DNA
Molecule : DNA (5'-D(*CP*TP*(BRU)P*AP*TP*(1WA)P*(1WA)P*(1WA)P*(1W5)MOLECULE: DNA (5'-D(*CP*TP*(BRU)P*AP*TP*(1WA)P*(1WA)P*(1WA)P*(1W5)
4XO0Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.70 Å
Title : CRYSTAL STRUCTURE OF 5'-CTTATPPTAZZATAAG IN A HOST-GUEST COMPLEXRYSTAL STRUCTURE OF 5'-CTTATPPTAZZATAAG IN A HOST-GUEST COMPLEX
Classification : TRANSFERASE/DNA
Molecule : DNA (5'-D(P*AP*(1W5)P*(1W5)P*AP*TP*AP*AP*G)-3');MOLECULE: DNA (5'-D(P*AP*(1W5)P*(1W5)P*AP*TP*AP*AP*G)-3');
4XPCDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.68 Å
Title : CRYSTAL STRUCTURE OF 5'- CTTATAAATTTATAAG IN A HOST-GUEST COMPLEXRYSTAL STRUCTURE OF 5'- CTTATAAATTTATAAG IN A HOST-GUEST COMPLEX
Classification : TRANSFERASE/DNA
Molecule : DNA (5'-D(P*TP*TP*TP*AP*TP*AP*AP*G)-3');MOLECULE: DNA (5'-D(P*TP*TP*TP*AP*TP*AP*AP*G)-3');
4XPEDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.78 Å
Title : CRYSTAL STRUCTURE OF 5'-CTTATGGGCCCATAAG IN A HOST-GUEST COMPLEXRYSTAL STRUCTURE OF 5'-CTTATGGGCCCATAAG IN A HOST-GUEST COMPLEX
Classification : TRANSFERASE/DNA
Molecule : DNA (5'-D(P*CP*CP*CP*AP*TP*AP*AP*G)-3');MOLECULE: DNA (5'-D(P*CP*CP*CP*AP*TP*AP*AP*G)-3');
4XPVDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION; NEUTRON DIFFRACTION with the resolution of 1.70 Å
Title : NEUTRON AND X-RAY STRUCTURE ANALYSIS OF XYLANASE: N44D AT PH6EUTRON AND X-RAY STRUCTURE ANALYSIS OF XYLANASE: N44D AT PH6
Classification : HYDROLASE
Molecule : ENDO-1,4-BETA-XYLANASE 2;MOLECULE: ENDO-1,4-BETA-XYLANASE 2;
4XPZDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.45 Å
Title : R271A BOUND TO ALUMINUM FLUORIDER271A BOUND TO ALUMINUM FLUORIDE
Classification : HYDROLASE
Molecule : RNA POLYMERASE II SUBUNIT A C-TERMINAL DOMAIN PHOSPHATASE;MOLECULE: RNA POLYMERASE II SUBUNIT A C-TERMINAL DOMAIN PHOSPHATASE;
4XQ0Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.85 Å
Title : R271A BOUND TO BERYLLIUM FLUORIDER271A BOUND TO BERYLLIUM FLUORIDE
Classification : HYDROLASE
Molecule : RNA POLYMERASE II SUBUNIT A C-TERMINAL DOMAIN PHOSPHATASE;MOLECULE: RNA POLYMERASE II SUBUNIT A C-TERMINAL DOMAIN PHOSPHATASE;
4XQ4Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.25 Å
Title : X-RAY STRUCTURE ANALYSIS OF XYLANASE - N44D-RAY STRUCTURE ANALYSIS OF XYLANASE - N44D
Classification : HYDROLASE
Molecule : ENDO-1,4-BETA-XYLANASE 2;MOLECULE: ENDO-1,4-BETA-XYLANASE 2;
4XQDDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.50 Å
Title : X-RAY STRUCTURE ANALYSIS OF XYLANASE-WT AT PH4.0-RAY STRUCTURE ANALYSIS OF XYLANASE-WT AT PH4.0
Classification : HYDROLASE
Molecule : ENDO-1,4-BETA-XYLANASE 2;MOLECULE: ENDO-1,4-BETA-XYLANASE 2;
4XQWDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.50 Å
Title : X-RAY STRUCTURE ANALYSIS OF XYLANASE-N44E WITH MES AT PH6.0-RAY STRUCTURE ANALYSIS OF XYLANASE-N44E WITH MES AT PH6.0
Classification : HYDROLASE
Molecule : ENDO-1,4-BETA-XYLANASE 2;MOLECULE: ENDO-1,4-BETA-XYLANASE 2;
4XR9Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.95 Å
Title : COCRYSTALLIZED WITH NAD AND TDP-GLUCOSECOCRYSTALLIZED WITH NAD AND TDP-GLUCOSE
Classification : OXIDOREDUCTASE
Molecule : CALS8;MOLECULE: CALS8;
4XTRDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.05 Å
Title : STRUCTURE OF GET3 BOUND TO THE TRANSMEMBRANE DOMAIN OF PEP12TRUCTURE OF GET3 BOUND TO THE TRANSMEMBRANE DOMAIN OF PEP12
Classification : HYDROLASE/TRANSPORT PROTEIN
Molecule : PEP12P;MOLECULE: PEP12P;
4XV4Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.69 Å
Title : CCP GATELESS CAVITYCP GATELESS CAVITY
Classification : OXIDOREDUCTASE
Molecule : CYTOCHROME C PEROXIDASE, MITOCHONDRIAL;MOLECULE: CYTOCHROME C PEROXIDASE, MITOCHONDRIAL;
4XV5Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.65 Å
Title : CCP GATELESS CAVITYCP GATELESS CAVITY
Classification : OXIDOREDUCTASE
Molecule : CYTOCHROME C PEROXIDASE, MITOCHONDRIAL;MOLECULE: CYTOCHROME C PEROXIDASE, MITOCHONDRIAL;
4XV6Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.55 Å
Title : CCP GATELESS CAVITYCP GATELESS CAVITY
Classification : OXIDOREDUCTASE
Molecule : CYTOCHROME C PEROXIDASE, MITOCHONDRIAL;MOLECULE: CYTOCHROME C PEROXIDASE, MITOCHONDRIAL;
4XV7Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.62 Å
Title : CCP GATELESS CAVITYCP GATELESS CAVITY
Classification : OXIDOREDUCTASE
Molecule : CYTOCHROME C PEROXIDASE, MITOCHONDRIAL;MOLECULE: CYTOCHROME C PEROXIDASE, MITOCHONDRIAL;
4XV8Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.57 Å
Title : CCP GATELESS CAVITYCP GATELESS CAVITY
Classification : OXIDOREDUCTASE
Molecule : CYTOCHROME C PEROXIDASE, MITOCHONDRIAL;MOLECULE: CYTOCHROME C PEROXIDASE, MITOCHONDRIAL;
4XVADeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.66 Å
Title : CRYSTAL STRUCTURE OF WILD TYPE CYTOCHROME C PEROXIDASERYSTAL STRUCTURE OF WILD TYPE CYTOCHROME C PEROXIDASE
Classification : OXIDOREDUCTASE
Molecule : CYTOCHROME C PEROXIDASE, MITOCHONDRIAL;MOLECULE: CYTOCHROME C PEROXIDASE, MITOCHONDRIAL;
4XVUDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.35 Å
Title : STRUCTURE OF GET3 BOUND TO THE TRANSMEMBRANE DOMAIN OF NYV1TRUCTURE OF GET3 BOUND TO THE TRANSMEMBRANE DOMAIN OF NYV1
Classification : HYDROLASE/TRANSPORT PROTEIN
Molecule : NYV1 TMD;MOLECULE: NYV1 TMD;
4XVVDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.70 Å
Title : RESOLUTIONRESOLUTION
Classification : CHAPERONE
Molecule : ACID STRESS CHAPERONE HDEB;MOLECULE: ACID STRESS CHAPERONE HDEB;
4XWODeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.75 Å
Title : STRUCTURE OF GET3 BOUND TO THE TRANSMEMBRANE DOMAIN OF SEC22TRUCTURE OF GET3 BOUND TO THE TRANSMEMBRANE DOMAIN OF SEC22
Classification : HYDROLASE/TRANSPORT PROTEIN
Molecule : SEC22;MOLECULE: SEC22;
4XZRDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.25 Å
Title : LOCALIZATION SIGNAL SEQUENCE OF INM PROTEIN HEH1LOCALIZATION SIGNAL SEQUENCE OF INM PROTEIN HEH1
Classification : MEMBRANE PROTEIN/NUCLEAR PROTEIN
Molecule : IMPORTIN SUBUNIT ALPHA;MOLECULE: IMPORTIN SUBUNIT ALPHA;
4Y0IDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.66 Å
Title : INACTIVATORINACTIVATOR
Classification : TRANSFERASE
Molecule : 4-AMINOBUTYRATE AMINOTRANSFERASE, MITOCHONDRIAL;MOLECULE: 4-AMINOBUTYRATE AMINOTRANSFERASE, MITOCHONDRIAL;
4Y1IDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.85 Å
Title : LACTOCOCCUS LACTIS YYBP-YKOY MN RIBOSWITCH BOUND TO MN2+ACTOCOCCUS LACTIS YYBP-YKOY MN RIBOSWITCH BOUND TO MN2+
Classification : RNA
Molecule : LACTOCOCCUS LACTIS YYBP-YKOY RIBOSWITCH;MOLECULE: LACTOCOCCUS LACTIS YYBP-YKOY RIBOSWITCH;
4Y1JDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.24 Å
Title : PRESENCE OF MN2+PRESENCE OF MN2+
Classification : RNA
Molecule : YYBP-YKOY RIBOSWITCH;MOLECULE: YYBP-YKOY RIBOSWITCH;
4Y1LDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.70 Å
Title : UBC9 HOMODIMER THE MISSING LINK IN POLY-SUMO CHAIN FORMATIONBC9 HOMODIMER THE MISSING LINK IN POLY-SUMO CHAIN FORMATION
Classification : LIGASE/NUCLEAR PROTEIN
Molecule : RWD DOMAIN-CONTAINING PROTEIN 3;MOLECULE: RWD DOMAIN-CONTAINING PROTEIN 3;
4Y1MDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 3.00 Å
Title : AN ESCHERICHIA COLI YYBP-YKOY MN RIBOSWITCH IN THE MN2+-FREE STATEN ESCHERICHIA COLI YYBP-YKOY MN RIBOSWITCH IN THE MN2+-FREE STATE
Classification : RNA
Molecule : E. COLI YYBP-YKOY RIBOSWITCH;MOLECULE: E. COLI YYBP-YKOY RIBOSWITCH;
4Y3UDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 3.51 Å
Title : THE STRUCTURE OF PHOSPHOLAMBAN BOUND TO THE CALCIUM PUMP SERCA1AHE STRUCTURE OF PHOSPHOLAMBAN BOUND TO THE CALCIUM PUMP SERCA1A
Classification : MEMBRANE PROTEIN
Molecule : CARDIAC PHOSPHOLAMBAN;MOLECULE: CARDIAC PHOSPHOLAMBAN;
4Y52Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 3.50 Å
Title : II DURING TRANSCRIPTION ELONGATION.II DURING TRANSCRIPTION ELONGATION.
Classification : TRANSCRIPTION/DNA/RNA
Molecule : RNA (5'-D(*AP*UP*GP*GP*AP*GP*AP*GP*G)-3');MOLECULE: RNA (5'-D(*AP*UP*GP*GP*AP*GP*AP*GP*G)-3');
4Y5JDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.30 Å
Title : DROSOPHILA MELANOGASTER MINI SPINDLES TOG3ROSOPHILA MELANOGASTER MINI SPINDLES TOG3
Classification : PROTEIN BINDING
Molecule : MINI SPINDLES TOG3;MOLECULE: MINI SPINDLES TOG3;
4Y5QDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.00 Å
Title : PARVUM (CPCDPK1) IN COMPLEX WITH AMPPARVUM (CPCDPK1) IN COMPLEX WITH AMP
Classification : TRANSFERASE
Molecule : CALMODULIN-DOMAIN PROTEIN KINASE 1, PUTATIVE;MOLECULE: CALMODULIN-DOMAIN PROTEIN KINASE 1, PUTATIVE;
4Y5RDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.80 Å
Title : CRYSTAL STRUCTURE OF A T67A MAUG/PRE-METHYLAMINE DEHYDROGENASE COMPLEXRYSTAL STRUCTURE OF A T67A MAUG/PRE-METHYLAMINE DEHYDROGENASE COMPLEX
Classification : OXIDOREDUCTASE
Molecule : METHYLAMINE DEHYDROGENASE HEAVY CHAIN;MOLECULE: METHYLAMINE DEHYDROGENASE HEAVY CHAIN;
4Y6WDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.59 Å
Title : NEARLY IDENTICAL TPR-LIKE REPEATSNEARLY IDENTICAL TPR-LIKE REPEATS
Classification : UNKNOWN FUNCTION
Molecule : NAB(AB)3ACB - LIGHT CHAIN TPR-LIKE REPEATS;MOLECULE: NAB(AB)3ACB - LIGHT CHAIN TPR-LIKE REPEATS;
4Y7CDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.20 Å
Title : RAT CYPOR MUTANT - G141DEL/E142NAT CYPOR MUTANT - G141DEL/E142N
Classification : OXIDOREDUCTASE
Molecule : NADPH--CYTOCHROME P450 REDUCTASE;MOLECULE: NADPH--CYTOCHROME P450 REDUCTASE;
4Y7NDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 3.30 Å
Title : POLYMERASE II DURING TRANSCRIPTION ELONGATION.POLYMERASE II DURING TRANSCRIPTION ELONGATION.
Classification : TRANSCRIPTION/DNA/RNA
Molecule : RNA (5'-D(*AP*UP*GP*GP*AP*GP*AP*GP*G)-3');MOLECULE: RNA (5'-D(*AP*UP*GP*GP*AP*GP*AP*GP*G)-3');
4Y7RDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.90 Å
Title : CRYSTAL STRUCTURE OF WDR5 IN COMPLEX WITH MYC MBIIIB PEPTIDERYSTAL STRUCTURE OF WDR5 IN COMPLEX WITH MYC MBIIIB PEPTIDE
Classification : DNA BINDING PROTEIN
Molecule : MYC MBIIIB PEPTIDE;MOLECULE: MYC MBIIIB PEPTIDE;
4Y86Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.01 Å
Title : CRYSTAL STRUCTURE OF PDE9 IN COMPLEX WITH RACEMIC INHIBITOR C33RYSTAL STRUCTURE OF PDE9 IN COMPLEX WITH RACEMIC INHIBITOR C33
Classification : HYDROLASE/HYDROLASE INHIBITOR
Molecule : HIGH AFFINITY CGMP-SPECIFIC 3',5'-CYCLIC PHOSPHODIESTERASEMOLECULE: HIGH AFFINITY CGMP-SPECIFIC 3',5'-CYCLIC PHOSPHODIESTERASE
4Y87Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 3.10 Å
Title : PYRAZOLO[3,4-D]PYRIMIDIN-4-ONE)PYRAZOLO[3,4-D]PYRIMIDIN-4-ONE)
Classification : HYDROLASE/HYDROLASE INHIBITOR
Molecule : HIGH AFFINITY CGMP-SPECIFIC 3',5'-CYCLIC PHOSPHODIESTERASEMOLECULE: HIGH AFFINITY CGMP-SPECIFIC 3',5'-CYCLIC PHOSPHODIESTERASE
4Y8WDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.64 Å
Title : CRYSTAL STRUCTURE OF HUMAN CYTOCHROME P450 21A2 PROGESTERONE COMPLEXRYSTAL STRUCTURE OF HUMAN CYTOCHROME P450 21A2 PROGESTERONE COMPLEX
Classification : OXIDOREDUCTASE
Molecule : CYTOCHROME P450 21-HYDROXYLASE;MOLECULE: CYTOCHROME P450 21-HYDROXYLASE;
4Y9RDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.40 Å
Title : RAT CYPOR MUTANT - G141DELAT CYPOR MUTANT - G141DEL
Classification : OXIDOREDUCTASE
Molecule : NADPH--CYTOCHROME P450 REDUCTASE;MOLECULE: NADPH--CYTOCHROME P450 REDUCTASE;
4Y9UDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.95 Å
Title : RAT CYPOR MUTANT - G143DELAT CYPOR MUTANT - G143DEL
Classification : OXIDOREDUCTASE
Molecule : NADPH--CYTOCHROME P450 REDUCTASE;MOLECULE: NADPH--CYTOCHROME P450 REDUCTASE;
4YAFDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.91 Å
Title : RAT CYPOR WITH 2'-AMPAT CYPOR WITH 2'-AMP
Classification : OXIDOREDUCTASE
Molecule : NADPH--CYTOCHROME P450 REDUCTASE;MOLECULE: NADPH--CYTOCHROME P450 REDUCTASE;
4YALDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.88 Å
Title : REDUCED CYPOR WITH 2'-AMPEDUCED CYPOR WITH 2'-AMP
Classification : OXIDOREDUCTASE
Molecule : NADPH--CYTOCHROME P450 REDUCTASE;MOLECULE: NADPH--CYTOCHROME P450 REDUCTASE;
4YAODeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.50 Å
Title : REDUCED CYPOR MUTANT - G143DELEDUCED CYPOR MUTANT - G143DEL
Classification : OXIDOREDUCTASE
Molecule : NADPH--CYTOCHROME P450 REDUCTASE;MOLECULE: NADPH--CYTOCHROME P450 REDUCTASE;
4YAUDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.20 Å
Title : REDUCED CYPOR MUTANT - G141DEL/E142NEDUCED CYPOR MUTANT - G141DEL/E142N
Classification : OXIDOREDUCTASE
Molecule : NADPH--CYTOCHROME P450 REDUCTASE;MOLECULE: NADPH--CYTOCHROME P450 REDUCTASE;
4YAWDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.00 Å
Title : REDUCED CYPOR MUTANT - G141DELEDUCED CYPOR MUTANT - G141DEL
Classification : OXIDOREDUCTASE
Molecule : NADPH--CYTOCHROME P450 REDUCTASE;MOLECULE: NADPH--CYTOCHROME P450 REDUCTASE;
4YBLDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 3.10 Å
Title : GP120 IN COMPLEX WITH THE ADCC MEDIATING ANTI-HIV-1 ANTIBODY A32GP120 IN COMPLEX WITH THE ADCC MEDIATING ANTI-HIV-1 ANTIBODY A32
Classification : VIRAL PROTEIN/IMMUNE SYSTEM
Molecule : A32 ANTIBODY LIGHT CHAIN;MOLECULE: A32 ANTIBODY LIGHT CHAIN;
4YBRDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.65 Å
Title : P21212P21212
Classification : TRANSFERASE
Molecule : NICOTINATE-NUCLEOTIDE ADENYLYLTRANSFERASE;MOLECULE: NICOTINATE-NUCLEOTIDE ADENYLYLTRANSFERASE;
4YC2Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 3.02 Å
Title : GP120 FROM E. COLI IN COMPLEX WITH THE ANTIBODY A32.GP120 FROM E. COLI IN COMPLEX WITH THE ANTIBODY A32.
Classification : VIRAL PROTEIN/IMMUNE SYSTEM
Molecule : THE ANTIBODY A32 FAB LIGHT CHAIN.;MOLECULE: THE ANTIBODY A32 FAB LIGHT CHAIN.;
4YCUDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.10 Å
Title : SYNTHETASESYNTHETASE
Classification : LIGASE/ LIGASE INHIBITOR
Molecule : AMINOACYL TRNA SYNTHASE COMPLEX-INTERACTING MULTIFUNCTIONALMOLECULE: AMINOACYL TRNA SYNTHASE COMPLEX-INTERACTING MULTIFUNCTIONAL
4YCVDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 3.41 Å
Title : SYNTHETASESYNTHETASE
Classification : LIGASE/LIGASE INHIBITOR
Molecule : LYSINE--TRNA LIGASE;MOLECULE: LYSINE--TRNA LIGASE;
4YCWDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.90 Å
Title : LYSYL-TRNA SYNTHETASE MUTANTLYSYL-TRNA SYNTHETASE MUTANT
Classification : LIGASE/LIGASE INHIBITOR
Molecule : AMINOACYL TRNA SYNTHASE COMPLEX-INTERACTING MULTIFUNCTIONALMOLECULE: AMINOACYL TRNA SYNTHASE COMPLEX-INTERACTING MULTIFUNCTIONAL
4YCXDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.10 Å
Title : SUBSTRATESUBSTRATE
Classification : TRANSFERASE/DNA
Molecule : DNA (5'-D(P*GP*CP*CP*G)-3');MOLECULE: DNA (5'-D(P*GP*CP*CP*G)-3');
4YCZDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 4.10 Å
Title : (A.K.A. T. HETEROTHALLICA)(A.K.A. T. HETEROTHALLICA)
Classification : STRUCTURAL PROTEIN
Molecule : NUP120;MOLECULE: NUP120;
4YD1Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.75 Å
Title : SUBSTRATE AND AN INCOMING NONHYDROLYZABLE DUMPNPPSUBSTRATE AND AN INCOMING NONHYDROLYZABLE DUMPNPP
Classification : TRANSFERASE/DNA
Molecule : DNA (5'-D(P*GP*CP*CP*G)-3');MOLECULE: DNA (5'-D(P*GP*CP*CP*G)-3');
4YD2Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.47 Å
Title : SUBSTRATESUBSTRATE
Classification : TRANSFERASE/DNA
Molecule : DNA (5'-D(P*GP*CP*CP*G)-3');MOLECULE: DNA (5'-D(P*GP*CP*CP*G)-3');
4YD8Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.80 Å
Title : BARDET-BIEDL SYNDROME 9 PROTEIN (AA1-407), HOMO SAPIENSARDET-BIEDL SYNDROME 9 PROTEIN (AA1-407), HOMO SAPIENS
Classification : PROTEIN TRANSPORT
Molecule : PROTEIN PTHB1;MOLECULE: PROTEIN PTHB1;
4YDSDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.30 Å
Title : FLAH FROM SULFOLOBUS ACIDOCALDARIUS WITH ATP AND MG-IONLAH FROM SULFOLOBUS ACIDOCALDARIUS WITH ATP AND MG-ION
Classification : HYDROLASE
Molecule : FLAGELLA-RELATED PROTEIN H;MOLECULE: FLAGELLA-RELATED PROTEIN H;
4YE5Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.05 Å
Title : BIFIDOBACTERIUM ADOLESCENTIS ATCC 15703BIFIDOBACTERIUM ADOLESCENTIS ATCC 15703
Classification : PENICILLIN BINDING PROTEIN
Molecule : PEPTIDOGLYCAN SYNTHETASE PENICILLIN-BINDING PROTEIN 3;MOLECULE: PEPTIDOGLYCAN SYNTHETASE PENICILLIN-BINDING PROTEIN 3;
4YERDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.35 Å
Title : FROM THERMOTOGA MARITIMA MSB8 AT 2.35 A RESOLUTIONFROM THERMOTOGA MARITIMA MSB8 AT 2.35 A RESOLUTION
Classification : HYDROLASE
Molecule : ABC TRANSPORTER ATP-BINDING PROTEIN;MOLECULE: ABC TRANSPORTER ATP-BINDING PROTEIN;
4YEUDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 4.60 Å
Title : ELIC-GLIC CHIMERA IN THE RESTING CONFORMATIONLIC-GLIC CHIMERA IN THE RESTING CONFORMATION
Classification : MEMBRANE PROTEIN
Molecule : CYS-LOOP LIGAND-GATED ION CHANNEL,PROTON-GATED ION CHANNEL;MOLECULE: CYS-LOOP LIGAND-GATED ION CHANNEL,PROTON-GATED ION CHANNEL;
4YFKDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 3.57 Å
Title : ESCHERICHIA COLI RNA POLYMERASE IN COMPLEX WITH SQUARAMIDE COMPOUND 8.SCHERICHIA COLI RNA POLYMERASE IN COMPLEX WITH SQUARAMIDE COMPOUND 8.
Classification : TRANSCRIPTION/TRANSCRIPTION INHIBITOR
Molecule : RNA POLYMERASE SIGMA FACTOR RPOD;MOLECULE: RNA POLYMERASE SIGMA FACTOR RPOD;
4YFNDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 3.82 Å
Title : CYCLOBUT-1-EN-1-YL]-3,5-DIMETHYL-1,2-OXAZOLE-4-SULFONAMIDE)CYCLOBUT-1-EN-1-YL]-3,5-DIMETHYL-1,2-OXAZOLE-4-SULFONAMIDE)
Classification : TRANSCRIPTION/TRANSCRIPTION INHIBITOR
Molecule : RNA POLYMERASE SIGMA FACTOR RPOD;MOLECULE: RNA POLYMERASE SIGMA FACTOR RPOD;
4YFSDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.10 Å
Title : RELEVANT FOR MALARIA VACCINE DESIGNRELEVANT FOR MALARIA VACCINE DESIGN
Classification : ERYTHROCYTE BINDING PROTEIN
Molecule : DUFFY RECEPTOR;MOLECULE: DUFFY RECEPTOR;
4YG2Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 3.70 Å
Title : HOLOENZYMEHOLOENZYME
Classification : TRANSFERASE/TRANSCRIPTION
Molecule : RNA POLYMERASE SIGMA FACTOR RPOD;MOLECULE: RNA POLYMERASE SIGMA FACTOR RPOD;
4YGADeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.94 Å
Title : CDPK1, FROM TOXOPLASMA GONDII, BOUND TO INHIBITORY VHH-1B7DPK1, FROM TOXOPLASMA GONDII, BOUND TO INHIBITORY VHH-1B7
Classification : METAL BINDING PROTEIN
Molecule : VHH-1B7;MOLECULE: VHH-1B7;
4YGODeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.50 Å
Title : CHOLERAE IN INTERMEDIATE STATECHOLERAE IN INTERMEDIATE STATE
Classification : TRANSFERASE
Molecule : SPERMIDINE N1-ACETYLTRANSFERASE;MOLECULE: SPERMIDINE N1-ACETYLTRANSFERASE;
4YHXDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.15 Å
Title : DNADNA
Classification : HYDROLASE/DNA
Molecule : DNA (27-MER);MOLECULE: DNA (27-MER);
4YI0Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.81 Å
Title : STRUCTURE OF MOUSE IMPORTIN A1 BOUND TO POM121NLSTRUCTURE OF MOUSE IMPORTIN A1 BOUND TO POM121NLS
Classification : PROTEIN TRANSPORT
Molecule : NUCLEAR ENVELOPE PORE MEMBRANE PROTEIN POM 121;MOLECULE: NUCLEAR ENVELOPE PORE MEMBRANE PROTEIN POM 121;
4YI8Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.20 Å
Title : RESOLUTION WITH CALCIUM IONS BOUND TO EF-HANDS 2 AND 3RESOLUTION WITH CALCIUM IONS BOUND TO EF-HANDS 2 AND 3
Classification : CALCIUM BINDING PROTEIN
Molecule : RECOVERIN;MOLECULE: RECOVERIN;
4YI9Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.35 Å
Title : TO EF-HAND 3TO EF-HAND 3
Classification : CALCIUM BINDING PROTEIN
Molecule : RECOVERIN;MOLECULE: RECOVERIN;
4YICDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.60 Å
Title : 500035) WITH BOUND PICOLINIC ACID500035) WITH BOUND PICOLINIC ACID
Classification : TRANSPORT PROTEIN
Molecule : TRAP TRANSPORTER SOLUTE BINDING PROTEIN;MOLECULE: TRAP TRANSPORTER SOLUTE BINDING PROTEIN;
4YISDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.89 Å
Title : DNADNA
Classification : HYDROLASE/DNA
Molecule : DNA (28-MER);MOLECULE: DNA (28-MER);
4YITDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 3.24 Å
Title : DNADNA
Classification : HYDROLASE/DNA
Molecule : DNA (25-MER);MOLECULE: DNA (25-MER);
4YIVDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.93 Å
Title : CRYSTAL STRUCTURE OF ENGINEERED TGAMA1 LACKING THE DII LOOPRYSTAL STRUCTURE OF ENGINEERED TGAMA1 LACKING THE DII LOOP
Classification : IMMUNE SYSTEM
Molecule : APICAL MEMBRANE ANTIGEN AMA1;MOLECULE: APICAL MEMBRANE ANTIGEN AMA1;
4YIZDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.20 Å
Title : WITH AN EIMERIA TENELLA RON2D3 PEPTIDEWITH AN EIMERIA TENELLA RON2D3 PEPTIDE
Classification : IMMUNE SYSTEM
Molecule : RHOPTRY NECK PROTEIN 2, PUTATIVE;MOLECULE: RHOPTRY NECK PROTEIN 2, PUTATIVE;
4YJ2Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.60 Å
Title : CRYSTAL STRUCTURE OF TUBULIN BOUND TO MI-181RYSTAL STRUCTURE OF TUBULIN BOUND TO MI-181
Classification : CELL CYCLE
Molecule : TUBULIN-TYROSINE LIGASE;MOLECULE: TUBULIN-TYROSINE LIGASE;
4YJ3Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 3.75 Å
Title : CRYSTAL STRUCTURE OF TUBULIN BOUND TO COMPOUND 2RYSTAL STRUCTURE OF TUBULIN BOUND TO COMPOUND 2
Classification : CELL CYCLE
Molecule : TUBULIN-TYROSINE LIGASE;MOLECULE: TUBULIN-TYROSINE LIGASE;
4YJMDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.95 Å
Title : THE APO STRUCTURE OF AGROBACTERIUM TUMEFACIENS CLPS2HE APO STRUCTURE OF AGROBACTERIUM TUMEFACIENS CLPS2
Classification : PROTEIN BINDING
Molecule : ATP-DEPENDENT CLP PROTEASE ADAPTER PROTEIN CLPS 2;MOLECULE: ATP-DEPENDENT CLP PROTEASE ADAPTER PROTEIN CLPS 2;
4YJNDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.60 Å
Title : COMPLEX WITH INHIBITOR UW1639COMPLEX WITH INHIBITOR UW1639
Classification : TRANSFERASE/TRANSFERASE INHIBITOR
Molecule : CALMODULIN-DOMAIN PROTEIN KINASE 1;MOLECULE: CALMODULIN-DOMAIN PROTEIN KINASE 1;
4YJXDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.55 Å
Title : PHENYLALANINAMIDEPHENYLALANINAMIDE
Classification : PROTEIN BINDING
Molecule : ATP-DEPENDENT CLP PROTEASE ADAPTER PROTEIN CLPS 2;MOLECULE: ATP-DEPENDENT CLP PROTEASE ADAPTER PROTEIN CLPS 2;
4YKADeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.80 Å
Title : TYROSINAMIDETYROSINAMIDE
Classification : PROTEIN BINDING
Molecule : ATP-DEPENDENT CLP PROTEASE ADAPTER PROTEIN CLPS 2;MOLECULE: ATP-DEPENDENT CLP PROTEASE ADAPTER PROTEIN CLPS 2;
4YLHDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.58 Å
Title : DIFFUSION PATHWAYDIFFUSION PATHWAY
Classification : HYDROLASE
Molecule : DPGC;MOLECULE: DPGC;
4YLMDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.05 Å
Title : AN ISONITRILE SYNTHETIC PATHWAYAN ISONITRILE SYNTHETIC PATHWAY
Classification : OXIDOREDUCTASE
Molecule : PYOVERDINE BIOSYNTHESIS PROTEIN PVCB;MOLECULE: PYOVERDINE BIOSYNTHESIS PROTEIN PVCB;
4YLRDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.55 Å
Title : TUBULIN GLUTAMYLASEUBULIN GLUTAMYLASE
Classification : LIGASE
Molecule : TUBULIN POLYGLUTAMYLASE TTLL7;MOLECULE: TUBULIN POLYGLUTAMYLASE TTLL7;
4YLSDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.60 Å
Title : TUBULIN GLUTAMYLASEUBULIN GLUTAMYLASE
Classification : LIGASE
Molecule : TUBULIN POLYGLUTAMYLASE TTLL7;MOLECULE: TUBULIN POLYGLUTAMYLASE TTLL7;
4YLUDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.10 Å
Title : INHIBITORINHIBITOR
Classification : HYDROLASE/HYDROLASE INHIBITOR
Molecule : ORF1A PROTEIN;MOLECULE: ORF1A PROTEIN;
4YMLDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.75 Å
Title : METHYLTHIO-DADME-IMMUCILLIN-AMETHYLTHIO-DADME-IMMUCILLIN-A
Classification : HYDROLASE/HYDROLASE INHIBITOR
Molecule : 5'-METHYLTHIOADENOSINE/S-ADENOSYLHOMOCYSTEINE NUCLEOSIDASE;MOLECULE: 5'-METHYLTHIOADENOSINE/S-ADENOSYLHOMOCYSTEINE NUCLEOSIDASE;
4YN0Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.20 Å
Title : CRYSTAL STRUCTURE OF APP E2 DOMAIN IN COMPLEX WITH DR6 CRD DOMAINRYSTAL STRUCTURE OF APP E2 DOMAIN IN COMPLEX WITH DR6 CRD DOMAIN
Classification : APOPTOSIS/CELL ADHESION
Molecule : AMYLOID BETA A4 PROTEIN;MOLECULE: AMYLOID BETA A4 PROTEIN;
4YNODeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.70 Å
Title : CRYSTAL STRUCTURE OF MAPK13 AT INACTIVE FORMRYSTAL STRUCTURE OF MAPK13 AT INACTIVE FORM
Classification : TRANSFERASE
Molecule : MITOGEN-ACTIVATED PROTEIN KINASE 13;MOLECULE: MITOGEN-ACTIVATED PROTEIN KINASE 13;
4YNRDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.92 Å
Title : DOSS GAFA DOMAIN REDUCED CO BOUND CRYSTAL STRUCTUREOSS GAFA DOMAIN REDUCED CO BOUND CRYSTAL STRUCTURE
Classification : OXIDOREDUCTASE
Molecule : REDOX SENSOR HISTIDINE KINASE RESPONSE REGULATOR DEVS;MOLECULE: REDOX SENSOR HISTIDINE KINASE RESPONSE REGULATOR DEVS;
4YO8Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.10 Å
Title : 5H-PYRROLO[3,2-D]PYRIMIDIN-7-YL)METHYL)(HEXYL)AMINO)METHANOL5H-PYRROLO[3,2-D]PYRIMIDIN-7-YL)METHYL)(HEXYL)AMINO)METHANOL
Classification : HYDROLASE/HYDROLASE INHIBITOR
Molecule : AMINODEOXYFUTALOSINE NUCLEOSIDASE;MOLECULE: AMINODEOXYFUTALOSINE NUCLEOSIDASE;
4YO9Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.30 Å
Title : HKU4 3CLPRO UNBOUND STRUCTUREKU4 3CLPRO UNBOUND STRUCTURE
Classification : HYDROLASE
Molecule : 3C-LIKE PROTEINASE;MOLECULE: 3C-LIKE PROTEINASE;
4YOEDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.92 Å
Title : STRUCTURE OF UP1 BOUND TO RNA 5'-AGU-3'TRUCTURE OF UP1 BOUND TO RNA 5'-AGU-3'
Classification : RNA BINDING PROTEIN/RNA
Molecule : RNA AGU;MOLECULE: RNA AGU;
4YOGDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.00 Å
Title : HKU4-3CLPRO BOUND TO NON-COVALENT INHIBITOR 3BKU4-3CLPRO BOUND TO NON-COVALENT INHIBITOR 3B
Classification : HYDROLASE/HYDROLASE INHIBITOR
Molecule : 3C-LIKE PROTEINASE;MOLECULE: 3C-LIKE PROTEINASE;
4YOIDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.82 Å
Title : STRUCTURE OF HKU4 3CLPRO BOUND TO NON-COVALENT INHIBITOR 1ATRUCTURE OF HKU4 3CLPRO BOUND TO NON-COVALENT INHIBITOR 1A
Classification : HYDROLASE/HYDROLASE INHIBITOR
Molecule : 3C-LIKE PROTEINASE;MOLECULE: 3C-LIKE PROTEINASE;
4YOJDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.90 Å
Title : HKU4 3CLPRO BOUND TO NON-COVALENT INHIBITOR 2AKU4 3CLPRO BOUND TO NON-COVALENT INHIBITOR 2A
Classification : HYDROLASE/HYDROLASE INHIBITOR
Molecule : 3C-LIKE PROTEINASE;MOLECULE: 3C-LIKE PROTEINASE;
4YOODeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.40 Å
Title : P107 POCKET DOMAIN IN COMPLEX WITH LIN52 P29A PEPTIDE107 POCKET DOMAIN IN COMPLEX WITH LIN52 P29A PEPTIDE
Classification : TRANSCRIPTION
Molecule : LIN52 PEPTIDE;MOLECULE: LIN52 PEPTIDE;
4YOSDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.30 Å
Title : P107 POCKET DOMAIN COMPLEXED WITH LIN52 PEPTIDE107 POCKET DOMAIN COMPLEXED WITH LIN52 PEPTIDE
Classification : TRANSCRIPTION
Molecule : PROTEIN LIN-52 HOMOLOG;MOLECULE: PROTEIN LIN-52 HOMOLOG;
4YOZDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.25 Å
Title : P107 POCKET DOMAIN IN COMPLEX WITH HPV E7 PEPTIDE107 POCKET DOMAIN IN COMPLEX WITH HPV E7 PEPTIDE
Classification : TRANSCRIPTION
Molecule : HPV E7 PEPTIDE;MOLECULE: HPV E7 PEPTIDE;
4YP3Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.89 Å
Title : 8-OXOGUANINE LESION8-OXOGUANINE LESION
Classification : TRANSFERASE/DNA
Molecule : DNA (5'-D(*AP*GP*CP*GP*TP*CP*AP*T)-3');MOLECULE: DNA (5'-D(*AP*GP*CP*GP*TP*CP*AP*T)-3');
4YQWDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.06 Å
Title : TEMPLATE GTEMPLATE G
Classification : TRANSFERASE/DNA
Molecule : DNA (5'-D(*AP*GP*CP*GP*TP*CP*AP*T)-3');MOLECULE: DNA (5'-D(*AP*GP*CP*GP*TP*CP*AP*T)-3');
4YR0Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.78 Å
Title : OXOGUANINE LESIONOXOGUANINE LESION
Classification : TRANSFERASE/DNA
Molecule : DNA (5'-D(*AP*GP*CP*GP*TP*CP*AP*T)-3');MOLECULE: DNA (5'-D(*AP*GP*CP*GP*TP*CP*AP*T)-3');
4YR2Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.95 Å
Title : OXOGUANINE LESIONOXOGUANINE LESION
Classification : TRANSFERASE/DNA
Molecule : DNA (5'-D(*AP*GP*CP*GP*TP*CP*AP*T)-3');MOLECULE: DNA (5'-D(*AP*GP*CP*GP*TP*CP*AP*T)-3');
4YR3Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.00 Å
Title : GG
Classification : TRANSFERASE/DNA
Molecule : DNA (5'-D(*AP*GP*CP*GP*TP*CP*AP*T)-3');MOLECULE: DNA (5'-D(*AP*GP*CP*GP*TP*CP*AP*T)-3');
4YS0Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.90 Å
Title : ATPASE SECA FROM THERMOTOGA MARITIMAATPASE SECA FROM THERMOTOGA MARITIMA
Classification : PROTEIN TRANSPORT
Molecule : PROTEIN TRANSLOCASE SUBUNIT SECA;MOLECULE: PROTEIN TRANSLOCASE SUBUNIT SECA;
4YS3Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 3.00 Å
Title : ACETYLATION NEAR THE NUCLEOSOME DYAD AXISACETYLATION NEAR THE NUCLEOSOME DYAD AXIS
Classification : STRUCTURAL PROTEIN/DNA
Molecule : DNA (147-MER);MOLECULE: DNA (147-MER);
4YS4Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.45 Å
Title : FALCIPARUMFALCIPARUM
Classification : IMMUNE SYSTEM
Molecule : MEROZOITE SURFACE PROTEIN P41;MOLECULE: MEROZOITE SURFACE PROTEIN P41;
4YSJDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.70 Å
Title : ADPADP
Classification : TRANSFERASE
Molecule : CALMODULIN-LIKE DOMAIN PROTEIN KINASE;MOLECULE: CALMODULIN-LIKE DOMAIN PROTEIN KINASE;
4YSMDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 3.19 Å
Title : CALCIUM-DEPENDENT PROTEIN KINASE FROM EIMERIA TENELLAALCIUM-DEPENDENT PROTEIN KINASE FROM EIMERIA TENELLA
Classification : TRANSFERASE
Molecule : CALMODULIN-LIKE DOMAIN PROTEIN KINASE;MOLECULE: CALMODULIN-LIKE DOMAIN PROTEIN KINASE;
4YUQDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.80 Å
Title : CDPK1 FROM EIMERIA TENELLA IN COMPLEX WITH INHIBITOR UW1354DPK1 FROM EIMERIA TENELLA IN COMPLEX WITH INHIBITOR UW1354
Classification : TRANSFERASE/TRANSFERASE INHIBITOR
Molecule : CALMODULIN-LIKE DOMAIN PROTEIN KINASE;MOLECULE: CALMODULIN-LIKE DOMAIN PROTEIN KINASE;
4YW8Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.55 Å
Title : ACIDACID
Classification : LYASE
Molecule : PHOSPHOENOLPYRUVATE CARBOXYKINASE, CYTOSOLIC [GTP];MOLECULE: PHOSPHOENOLPYRUVATE CARBOXYKINASE, CYTOSOLIC [GTP];
4YW9Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.40 Å
Title : ACID AND GTPACID AND GTP
Classification : LYASE
Molecule : PHOSPHOENOLPYRUVATE CARBOXYKINASE, CYTOSOLIC [GTP];MOLECULE: PHOSPHOENOLPYRUVATE CARBOXYKINASE, CYTOSOLIC [GTP];
4YWBDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.50 Å
Title : ACID AND OXALIC ACIDACID AND OXALIC ACID
Classification : LYASE
Molecule : PHOSPHOENOLPYRUVATE CARBOXYKINASE, CYTOSOLIC [GTP];MOLECULE: PHOSPHOENOLPYRUVATE CARBOXYKINASE, CYTOSOLIC [GTP];
4YWDDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.10 Å
Title : DICARBOXYLIC ACIDDICARBOXYLIC ACID
Classification : LYASE
Molecule : PHOSPHOENOLPYRUVATE CARBOXYKINASE, CYTOSOLIC [GTP];MOLECULE: PHOSPHOENOLPYRUVATE CARBOXYKINASE, CYTOSOLIC [GTP];
4YWKDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.55 Å
Title : B DELETEDB DELETED
Classification : CELL CYCLE
Molecule : CELL DIVISION CONTROL PROTEIN 21;MOLECULE: CELL DIVISION CONTROL PROTEIN 21;
4YWLDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 3.20 Å
Title : PENTAMERIC RINGPENTAMERIC RING
Classification : CELL CYCLE
Molecule : CELL DIVISION CONTROL PROTEIN 21;MOLECULE: CELL DIVISION CONTROL PROTEIN 21;
4YWMDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 3.20 Å
Title : PENTAMERIC RINGPENTAMERIC RING
Classification : CELL CYCLE
Molecule : CELL DIVISION CONTROL PROTEIN 21;MOLECULE: CELL DIVISION CONTROL PROTEIN 21;
4YYFDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.92 Å
Title : FROM [MYCOBACTERIUM SMEGMATIS STR. MC2 155FROM [MYCOBACTERIUM SMEGMATIS STR. MC2 155
Classification : HYDROLASE
Molecule : BETA-N-ACETYLHEXOSAMINIDASE;MOLECULE: BETA-N-ACETYLHEXOSAMINIDASE;
4YYXDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.79 Å
Title : CLAUDIN2 C-TERMINAL TAILCLAUDIN2 C-TERMINAL TAIL
Classification : CELL ADHESION
Molecule : TIGHT JUNCTION PROTEIN ZO-1 FUSED WITH CLAUDIN-2 C-MOLECULE: TIGHT JUNCTION PROTEIN ZO-1 FUSED WITH CLAUDIN-2 C-
4YZ0Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.15 Å
Title : WITH TRIGALACTURONIC ACIDWITH TRIGALACTURONIC ACID
Classification : LYASE
Molecule : PECTATE LYASE;MOLECULE: PECTATE LYASE;
4YZADeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.25 Å
Title : WITH TRIGALACTURONIC ACIDWITH TRIGALACTURONIC ACID
Classification : LYASE
Molecule : PECTATE LYASE;MOLECULE: PECTATE LYASE;
4YZBDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.90 Å
Title : CDPK1 FROM EIMERIA TENELLA IN COMPLEX WITH INHIBITOR UW1521DPK1 FROM EIMERIA TENELLA IN COMPLEX WITH INHIBITOR UW1521
Classification : TRANSFERASE/TRANSFERASE INHIBITOR
Molecule : CALMODULIN-LIKE DOMAIN PROTEIN KINASE;MOLECULE: CALMODULIN-LIKE DOMAIN PROTEIN KINASE;
4YZQDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.48 Å
Title : WITH TRIGALACTURONIC ACIDWITH TRIGALACTURONIC ACID
Classification : LYASE
Molecule : PECTATE LYASE;MOLECULE: PECTATE LYASE;
4YZXDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.25 Å
Title : WITH TRIGALACTURONIC ACIDWITH TRIGALACTURONIC ACID
Classification : LYASE
Molecule : PECTATE LYASE;MOLECULE: PECTATE LYASE;
4Z03Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.40 Å
Title : TRIGALACTURONIC ACIDTRIGALACTURONIC ACID
Classification : LYASE
Molecule : PECTATE LYASE;MOLECULE: PECTATE LYASE;
4Z05Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.50 Å
Title : C. BESCII FAMILY 3 PECTATE LYASE MUTANT E84A. BESCII FAMILY 3 PECTATE LYASE MUTANT E84A
Classification : LYASE
Molecule : PECTATE LYASE;MOLECULE: PECTATE LYASE;
4Z06Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.55 Å
Title : WITH ALPHA-D-GALACTOPYRANURONIC ACIDWITH ALPHA-D-GALACTOPYRANURONIC ACID
Classification : LYASE
Molecule : PECTATE LYASE;MOLECULE: PECTATE LYASE;
4Z0UDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.00 Å
Title : RNASE HI/SSB-CT COMPLEXNASE HI/SSB-CT COMPLEX
Classification : HYDROLASE/PEPTIDE
Molecule : SSB-CT PEPTIDE;MOLECULE: SSB-CT PEPTIDE;
4Z1TDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.50 Å
Title : METHYL]BENZONITRILEMETHYL]BENZONITRILE
Classification : ISOMERASE/ISOMERASE INHIBITOR
Molecule : MACROPHAGE MIGRATION INHIBITORY FACTOR;MOLECULE: MACROPHAGE MIGRATION INHIBITORY FACTOR;
4Z1UDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.05 Å
Title : MIF IN COMPLEX WITH 1-(4-METHYLPHENYL)-3-PHENYLPROP-2-YN-1-ONEIF IN COMPLEX WITH 1-(4-METHYLPHENYL)-3-PHENYLPROP-2-YN-1-ONE
Classification : ISOMERASE/ISOMERASE INHIBITOR
Molecule : MACROPHAGE MIGRATION INHIBITORY FACTOR;MOLECULE: MACROPHAGE MIGRATION INHIBITORY FACTOR;
4Z1XDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.80 Å
Title : WITH DNA TARGETWITH DNA TARGET
Classification : HYDROLASE/DNA
Molecule : LAGLIDADG ENDONUCLEASE;MOLECULE: LAGLIDADG ENDONUCLEASE;
4Z1ZDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 3.20 Å
Title : WITH A TTCT CENTRAL FOURWITH A TTCT CENTRAL FOUR
Classification : HYDROLASE/DNA
Molecule : DNA (28-MER);MOLECULE: DNA (28-MER);
4Z3JDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.50 Å
Title : SPACE GROUP P1SPACE GROUP P1
Classification : SUGAR BINDING PROTEIN
Molecule : PAPG, LECTIN DOMAIN;MOLECULE: PAPG, LECTIN DOMAIN;
4Z3TDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.62 Å
Title : MENINGOCOCCAL FACTOR H BINDING PROTEIN MUTANT L130R/G133DENINGOCOCCAL FACTOR H BINDING PROTEIN MUTANT L130R/G133D
Classification : PROTEIN BINDING
Molecule : FACTOR H BINDING PROTEIN VARIANT A10_001;MOLECULE: FACTOR H BINDING PROTEIN VARIANT A10_001;
4Z3UDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.71 Å
Title : PRV NUCLEAR EGRESS COMPLEXRV NUCLEAR EGRESS COMPLEX
Classification : VIRAL PROTEIN
Molecule : UL31;MOLECULE: UL31;
4Z4CDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.30 Å
Title : HUMAN ARGONAUTE2 BOUND TO T1-C TARGET RNAUMAN ARGONAUTE2 BOUND TO T1-C TARGET RNA
Classification : HYDROLASE/RNA
Molecule : RNA (5'-R(*CP*AP*AP*UP*GP*UP*GP*AP*C)-3');MOLECULE: RNA (5'-R(*CP*AP*AP*UP*GP*UP*GP*AP*C)-3');
4Z4DDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.60 Å
Title : HUMAN ARGONAUTE2 BOUND TO T1-G TARGET RNAUMAN ARGONAUTE2 BOUND TO T1-G TARGET RNA
Classification : GENE REGULATION/RNA
Molecule : RNA (5'-R(*CP*AP*AP*UP*GP*UP*GP*AP*G)-3');MOLECULE: RNA (5'-R(*CP*AP*AP*UP*GP*UP*GP*AP*G)-3');
4Z4EDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.80 Å
Title : HUMAN ARGONAUTE2 BOUND TO T1-U TARGET RNAUMAN ARGONAUTE2 BOUND TO T1-U TARGET RNA
Classification : GENE REGULATION/RNA
Molecule : RNA (5'-R(*CP*AP*AP*UP*GP*UP*GP*AP*U)-3');MOLECULE: RNA (5'-R(*CP*AP*AP*UP*GP*UP*GP*AP*U)-3');
4Z4GDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.70 Å
Title : HUMAN ARGONAUTE2 BOUND TO T1-INOSINE TARGET RNAUMAN ARGONAUTE2 BOUND TO T1-INOSINE TARGET RNA
Classification : GENE REGULATION/RNA
Molecule : RNA (5'-R(*CP*AP*AP*UP*GP*UP*GP*A)-D(P*(IMP))-3');MOLECULE: RNA (5'-R(*CP*AP*AP*UP*GP*UP*GP*A)-D(P*(IMP))-3');
4Z4HDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.50 Å
Title : HUMAN ARGONAUTE2 A481T MUTANT BOUND TO T1-A TARGET RNAUMAN ARGONAUTE2 A481T MUTANT BOUND TO T1-A TARGET RNA
Classification : GENE REGULATION/RNA
Molecule : RNA (5'-R(*CP*AP*AP*UP*GP*UP*GP*A)-3');MOLECULE: RNA (5'-R(*CP*AP*AP*UP*GP*UP*GP*A)-3');
4Z4IDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.80 Å
Title : HUMAN ARGONAUTE2 A481T MUTANT BOUND TO T1-G TARGET RNAUMAN ARGONAUTE2 A481T MUTANT BOUND TO T1-G TARGET RNA
Classification : GENE REGULATION/RNA
Molecule : RNA (5'-R(*CP*AP*AP*UP*GP*UP*GP*A)-3');MOLECULE: RNA (5'-R(*CP*AP*AP*UP*GP*UP*GP*A)-3');
4Z5PDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.90 Å
Title : AT 1.9 A RESOLUTIONAT 1.9 A RESOLUTION
Classification : OXIDOREDUCTASE
Molecule : CYTOCHROME P450 HYDROXYLASE;MOLECULE: CYTOCHROME P450 HYDROXYLASE;
4Z5QDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.80 Å
Title : AT 1.8 A RESOLUTIONAT 1.8 A RESOLUTION
Classification : OXIDOREDUCTASE
Molecule : CYTOCHROME P450 HYDROXYLASE;MOLECULE: CYTOCHROME P450 HYDROXYLASE;
4Z66Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.50 Å
Title : ACETYLATION NEAR THE NUCLEOSOME DYAD AXISACETYLATION NEAR THE NUCLEOSOME DYAD AXIS
Classification : STRUCTURAL PROTEIN/DNA
Molecule : DNA (147-MER);MOLECULE: DNA (147-MER);
4Z6LDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION
Title : B.FUSCUM AT 1.65 ANG RESOLUTIONB.FUSCUM AT 1.65 ANG RESOLUTION
Classification : OXIDOREDUCTASE
Molecule : HOMOPROTOCATECHUATE 2,3-DIOXYGENASE;MOLECULE: HOMOPROTOCATECHUATE 2,3-DIOXYGENASE;
4Z6MDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION
Title : B.FUSCUM AT 1.35 ANG RESOLUTIONB.FUSCUM AT 1.35 ANG RESOLUTION
Classification : OXIDOREDUCTASE
Molecule : HOMOPROTOCATECHUATE 2,3-DIOXYGENASE;MOLECULE: HOMOPROTOCATECHUATE 2,3-DIOXYGENASE;
4Z6NDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION
Title : B.FUSCUM AT 1.52 ANG RESOLUTIONB.FUSCUM AT 1.52 ANG RESOLUTION
Classification : OXIDOREDUCTASE
Molecule : HOMOPROTOCATECHUATE 2,3-DIOXYGENASE;MOLECULE: HOMOPROTOCATECHUATE 2,3-DIOXYGENASE;
4Z6ODeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION
Title : B.FUSCUM IN COMPLEX WITH HPCA AT 1.63 ANG RESOLUTIONB.FUSCUM IN COMPLEX WITH HPCA AT 1.63 ANG RESOLUTION
Classification : OXIDOREDUCTASE
Molecule : HOMOPROTOCATECHUATE 2,3-DIOXYGENASE;MOLECULE: HOMOPROTOCATECHUATE 2,3-DIOXYGENASE;
4Z6PDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION
Title : B.FUSCUM IN COMPLEX WITH HPCA AT 1.75 ANG RESOLUTIONB.FUSCUM IN COMPLEX WITH HPCA AT 1.75 ANG RESOLUTION
Classification : OXIDOREDUCTASE
Molecule : HOMOPROTOCATECHUATE 2,3-DIOXYGENASE;MOLECULE: HOMOPROTOCATECHUATE 2,3-DIOXYGENASE;
4Z6QDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION
Title : B.FUSCUM IN COMPLEX WITH HPCA AT 1.57 ANG RESOLUTIONB.FUSCUM IN COMPLEX WITH HPCA AT 1.57 ANG RESOLUTION
Classification : OXIDOREDUCTASE
Molecule : HOMOPROTOCATECHUATE 2,3-DIOXYGENASE;MOLECULE: HOMOPROTOCATECHUATE 2,3-DIOXYGENASE;
4Z6RDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION
Title : B.FUSCUM IN COMPLEX WITH 4-SULFONYL CATECHOL AT 1.70 ANG RESOLUTIONB.FUSCUM IN COMPLEX WITH 4-SULFONYL CATECHOL AT 1.70 ANG RESOLUTION
Classification : OXIDOREDUCTASE
Molecule : HOMOPROTOCATECHUATE 2,3-DIOXYGENASE;MOLECULE: HOMOPROTOCATECHUATE 2,3-DIOXYGENASE;
4Z6SDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION
Title : B.FUSCUM IN COMPLEX WITH 4-SULFONYL CATECHOL AT 1.42 ANG RESOLUTIONB.FUSCUM IN COMPLEX WITH 4-SULFONYL CATECHOL AT 1.42 ANG RESOLUTION
Classification : OXIDOREDUCTASE
Molecule : HOMOPROTOCATECHUATE 2,3-DIOXYGENASE;MOLECULE: HOMOPROTOCATECHUATE 2,3-DIOXYGENASE;
4Z6TDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION
Title : B.FUSCUM IN COMPLEX WITH 4-SULFONYL CATECHOL AT 1.50 ANG RESOLUTIONB.FUSCUM IN COMPLEX WITH 4-SULFONYL CATECHOL AT 1.50 ANG RESOLUTION
Classification : OXIDOREDUCTASE
Molecule : HOMOPROTOCATECHUATE 2,3-DIOXYGENASE;MOLECULE: HOMOPROTOCATECHUATE 2,3-DIOXYGENASE;
4Z6UDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION
Title : B.FUSCUM IN COMPLEX WITH 4-NITROCATECHOL AT 1.48 ANG RESOLUTIONB.FUSCUM IN COMPLEX WITH 4-NITROCATECHOL AT 1.48 ANG RESOLUTION
Classification : OXIDOREDUCTASE
Molecule : HOMOPROTOCATECHUATE 2,3-DIOXYGENASE;MOLECULE: HOMOPROTOCATECHUATE 2,3-DIOXYGENASE;
4Z6VDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION
Title : B.FUSCUM IN COMPLEX WITH 4-NITROCATECHOL AT 1.37 ANG RESOLUTIONB.FUSCUM IN COMPLEX WITH 4-NITROCATECHOL AT 1.37 ANG RESOLUTION
Classification : OXIDOREDUCTASE
Molecule : HOMOPROTOCATECHUATE 2,3-DIOXYGENASE;MOLECULE: HOMOPROTOCATECHUATE 2,3-DIOXYGENASE;
4Z6WDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION
Title : B.FUSCUM IN COMPLEX WITH 4-NITROCATECHOL AT 1.57 ANG RESOLUTIONB.FUSCUM IN COMPLEX WITH 4-NITROCATECHOL AT 1.57 ANG RESOLUTION
Classification : OXIDOREDUCTASE
Molecule : HOMOPROTOCATECHUATE 2,3-DIOXYGENASE;MOLECULE: HOMOPROTOCATECHUATE 2,3-DIOXYGENASE;
4Z6ZDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION
Title : COMPLEX WITH 4-SULFONYL CATECHOL AT 1.52 ANG RESOLUTIONCOMPLEX WITH 4-SULFONYL CATECHOL AT 1.52 ANG RESOLUTION
Classification : OXIDOREDUCTASE
Molecule : HOMOPROTOCATECHUATE 2,3-DIOXYGENASE;MOLECULE: HOMOPROTOCATECHUATE 2,3-DIOXYGENASE;
4Z79Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.54 Å
Title : LEIOMODIN-1 ACTIN-BINDING SITE 2 (ABS2)EIOMODIN-1 ACTIN-BINDING SITE 2 (ABS2)
Classification : PROTEIN BINDING
Molecule : LEIOMODIN-1 ACTIN-BINDING SITE 2 (ABS2);MOLECULE: LEIOMODIN-1 ACTIN-BINDING SITE 2 (ABS2);
4Z7KDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 3.00 Å
Title : CRYSTAL STRUCTURE OF CRISPR RNA PROCESSING ENDORIBONUCLEASE CAS6BRYSTAL STRUCTURE OF CRISPR RNA PROCESSING ENDORIBONUCLEASE CAS6B
Classification : HYDROLASE/RNA/DNA
Molecule : RNA/DNA HYBRID (31-MER);MOLECULE: RNA/DNA HYBRID (31-MER);
4Z7XDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.55 Å
Title : MDBA PROTEIN, A THIOL-DISULFIDE OXIDOREDUCTASE FROM ACTINOMYCES ORIS.DBA PROTEIN, A THIOL-DISULFIDE OXIDOREDUCTASE FROM ACTINOMYCES ORIS.
Classification : OXIDOREDUCTASE
Molecule : MDBA;MOLECULE: MDBA;
4Z80Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.53 Å
Title : WITH A 33 AA TGRON2L1 PEPTIDEWITH A 33 AA TGRON2L1 PEPTIDE
Classification : MEMBRANE PROTEIN
Molecule : CYTOADHERENCE-LINKED ASEXUAL PROTEIN;MOLECULE: CYTOADHERENCE-LINKED ASEXUAL PROTEIN;
4Z81Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.05 Å
Title : CRYSTAL STRUCTURE OF AMA4 DI-DII-EGF1 FROM TOXOPLASMA GONDIIRYSTAL STRUCTURE OF AMA4 DI-DII-EGF1 FROM TOXOPLASMA GONDII
Classification : MEMBRANE PROTEIN
Molecule : EGF FAMILY DOMAIN-CONTAINING PROTEIN;MOLECULE: EGF FAMILY DOMAIN-CONTAINING PROTEIN;
4Z8LDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.60 Å
Title : CRYSTAL STRUCTURE OF DCAF1/SIV-MND VPX/MND SAMHD1 NTD TERNARY COMPLEXRYSTAL STRUCTURE OF DCAF1/SIV-MND VPX/MND SAMHD1 NTD TERNARY COMPLEX
Classification : VIRAL PROTEIN/VPX-BINDING PROTEIN
Molecule : SAM DOMAIN AND HD DOMAIN-CONTAINING PROTEIN;MOLECULE: SAM DOMAIN AND HD DOMAIN-CONTAINING PROTEIN;
4Z8QDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.89 Å
Title : SELENOMETHIONINE SUBSTITUTED.SELENOMETHIONINE SUBSTITUTED.
Classification : PROTEIN BINDING
Molecule : AVRRXO1-ORF2;MOLECULE: AVRRXO1-ORF2;
4Z8TDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.64 Å
Title : CRYSTAL STRUCTURE OF AVRRXO1-ORF1:AVRRXO1-ORF2 WITH SULPHATE IONSRYSTAL STRUCTURE OF AVRRXO1-ORF1:AVRRXO1-ORF2 WITH SULPHATE IONS
Classification : PROTEIN BINDING
Molecule : AVRRXO1-ORF2;MOLECULE: AVRRXO1-ORF2;
4Z8UDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.65 Å
Title : CRYSTAL STRUCTURE OF AVRRXO1-ORF1:-ORF2 WITH ATPRYSTAL STRUCTURE OF AVRRXO1-ORF1:-ORF2 WITH ATP
Classification : PROTEIN BINDING
Molecule : AVRRXO1-ORF2;MOLECULE: AVRRXO1-ORF2;
4Z8VDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.30 Å
Title : CRYSTAL STRUCTURE OF AVRRXO1-ORF1:-ORF2 COMPLEX, NATIVE.RYSTAL STRUCTURE OF AVRRXO1-ORF1:-ORF2 COMPLEX, NATIVE.
Classification : PROTEIN BINDING
Molecule : AVRRXO1-ORF2;MOLECULE: AVRRXO1-ORF2;
4ZAIDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.95 Å
Title : CRYSTAL STRUCTURE OF CXCL13RYSTAL STRUCTURE OF CXCL13
Classification : CYTOKINE
Molecule : C-X-C MOTIF CHEMOKINE 13;MOLECULE: C-X-C MOTIF CHEMOKINE 13;
4ZBFDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.20 Å
Title : MCL-1 COMPLEXED WITH SMALL MOLECULESCL-1 COMPLEXED WITH SMALL MOLECULES
Classification : APOPTOSIS/APOPTOSIS INHIBITOR
Molecule : INDUCED MYELOID LEUKEMIA CELL DIFFERENTIATION PROTEIN MCL-MOLECULE: INDUCED MYELOID LEUKEMIA CELL DIFFERENTIATION PROTEIN MCL-
4ZBKDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.18 Å
Title : CRYSTAL STRUCTURE OF HUMAN GGT1 IN COMPLEX WITH GGSTOP INHIBITORRYSTAL STRUCTURE OF HUMAN GGT1 IN COMPLEX WITH GGSTOP INHIBITOR
Classification : HYDROLASE/HYDROLASE INHIBITOR
Molecule : GAMMA-GLUTAMYLTRANSPEPTIDASE 1;MOLECULE: GAMMA-GLUTAMYLTRANSPEPTIDASE 1;
4ZBODeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.40 Å
Title : FORMATEFORMATE
Classification : LYASE
Molecule : ACETOACETATE DECARBOXYLASE;MOLECULE: ACETOACETATE DECARBOXYLASE;
4ZBTDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.80 Å
Title : COMPLEX WITH PYRUVATECOMPLEX WITH PYRUVATE
Classification : LYASE
Molecule : ACETOACETATE DECARBOXYLASE;MOLECULE: ACETOACETATE DECARBOXYLASE;
4ZC6Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.10 Å
Title : CRYSTAL STRUCTURE OF HUMAN GGT1 IN COMPLEX WITH SERINE BORATERYSTAL STRUCTURE OF HUMAN GGT1 IN COMPLEX WITH SERINE BORATE
Classification : HYDROLASE/HYDROLASE INHIBITOR
Molecule : GAMMA-GLUTAMYLTRANSPEPTIDASE 1 LIGHT CHAIN;MOLECULE: GAMMA-GLUTAMYLTRANSPEPTIDASE 1 LIGHT CHAIN;
4ZCEDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.55 Å
Title : DERMATOPHAGOIDES PTERONYSSINUSDERMATOPHAGOIDES PTERONYSSINUS
Classification : ALLERGEN
Molecule : DUST MITE ALLERGEN;MOLECULE: DUST MITE ALLERGEN;
4ZCFDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.60 Å
Title : RANGE DIFFUSION BY ECOP15IRANGE DIFFUSION BY ECOP15I
Classification : HYDROLASE-DNA COMPLEX
Molecule : DNA 20-MER AATCATAGTCTACTGCTGTA;MOLECULE: DNA 20-MER AATCATAGTCTACTGCTGTA;
4ZCGDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.22 Å
Title : ATOMS OF GLUTAMATE)ATOMS OF GLUTAMATE)
Classification : HYDROLASE
Molecule : GAMMA-GLUTAMYLTRANSPEPTIDASE 1 LIGHT CHAIN;MOLECULE: GAMMA-GLUTAMYLTRANSPEPTIDASE 1 LIGHT CHAIN;
4ZD4Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.63 Å
Title : CATALYTIC DOMAIN OF SST2 F403W MUTANTATALYTIC DOMAIN OF SST2 F403W MUTANT
Classification : HYDROLASE
Molecule : AMSH-LIKE PROTEASE SST2;MOLECULE: AMSH-LIKE PROTEASE SST2;
4ZD5Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.07 Å
Title : CATALYTIC DOMAIN OF SST2 F403A MUTANTATALYTIC DOMAIN OF SST2 F403A MUTANT
Classification : HYDROLASE
Molecule : AMSH-LIKE PROTEASE SST2;MOLECULE: AMSH-LIKE PROTEASE SST2;
4ZDLDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.26 Å
Title : THE CRYSTAL STRUCTURE OF THE T325S MUTANT OF THE HUMAN HOLO SEPSECSHE CRYSTAL STRUCTURE OF THE T325S MUTANT OF THE HUMAN HOLO SEPSECS
Classification : TRANSFERASE
Molecule : O-PHOSPHOSERYL-TRNA(SEC) SELENIUM TRANSFERASE;MOLECULE: O-PHOSPHOSERYL-TRNA(SEC) SELENIUM TRANSFERASE;
4ZDODeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.65 Å
Title : SELENOCYSTEINE TRNA (TRNASEC)SELENOCYSTEINE TRNA (TRNASEC)
Classification : TRANSFERASE/RNA
Molecule : SELENOCYSTEINE TRNA;MOLECULE: SELENOCYSTEINE TRNA;
4ZDPDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.70 Å
Title : SELENOCYSTEINE TRNA (TRNASEC)SELENOCYSTEINE TRNA (TRNASEC)
Classification : TRANSFERASE/RNA
Molecule : SELENOCYSTEINE TRNA;MOLECULE: SELENOCYSTEINE TRNA;
4ZDWDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.90 Å
Title : WITH SEC2P AND GDPWITH SEC2P AND GDP
Classification : GTP BINDING PROTEIN
Molecule : RAB GUANINE NUCLEOTIDE EXCHANGE FACTOR SEC2;MOLECULE: RAB GUANINE NUCLEOTIDE EXCHANGE FACTOR SEC2;
4ZF3Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.90 Å
Title : CIRCULAR PERMUTANT ( 50-51)CIRCULAR PERMUTANT ( 50-51)
Classification : FLUORESCENT PROTEIN
Molecule : GREEN FLUORESCENT PROTEIN;MOLECULE: GREEN FLUORESCENT PROTEIN;
4ZF4Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.82 Å
Title : H148D; CIRCULAR PERMUTANT (50-51)H148D; CIRCULAR PERMUTANT (50-51)
Classification : FLUORESCENT PROTEIN
Molecule : GREEN FLUORESCENT PROTEIN;MOLECULE: GREEN FLUORESCENT PROTEIN;
4ZF5Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.70 Å
Title : H148D; CIRCULAR PERMUTANT ( 50-51)H148D; CIRCULAR PERMUTANT ( 50-51)
Classification : FLUORESCENT PROTEIN
Molecule : GREEN FLUORESCENT PROTEIN;MOLECULE: GREEN FLUORESCENT PROTEIN;
4ZFRDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.72 Å
Title : CATALYTIC DOMAIN OF SST2 F403A MUTANT BOUND TO UBIQUITINATALYTIC DOMAIN OF SST2 F403A MUTANT BOUND TO UBIQUITIN
Classification : HYDROLASE
Molecule : UBIQUITIN;MOLECULE: UBIQUITIN;
4ZFTDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.30 Å
Title : CATALYTIC DOMAIN OF SST2 F403W MUTANT BOUND TO UBIQUITINATALYTIC DOMAIN OF SST2 F403W MUTANT BOUND TO UBIQUITIN
Classification : HYDROLASE
Molecule : POLYUBIQUITIN-B;MOLECULE: POLYUBIQUITIN-B;
4ZHNDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.33 Å
Title : 2-OXOGLUTARATE, AND METHYLATED TRINUCLEOTIDE T-MEA-T2-OXOGLUTARATE, AND METHYLATED TRINUCLEOTIDE T-MEA-T
Classification : OXIDOREDUCTASE/DNA
Molecule : ALPHA-KETOGLUTARATE-DEPENDENT DIOXYGENASE ALKB;MOLECULE: ALPHA-KETOGLUTARATE-DEPENDENT DIOXYGENASE ALKB;
4ZIEDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.80 Å
Title : CRYSTAL STRUCTURE OF CORE/LATCH DIMER OF BAX IN COMPLEX WITH BIMBH3RYSTAL STRUCTURE OF CORE/LATCH DIMER OF BAX IN COMPLEX WITH BIMBH3
Classification : APOPTOSIS
Molecule : BCL-2-LIKE PROTEIN 11;MOLECULE: BCL-2-LIKE PROTEIN 11;
4ZIFDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.40 Å
Title : BIMBH3MINIBIMBH3MINI
Classification : APOPTOSIS
Molecule : BCL-2-LIKE PROTEIN 11;MOLECULE: BCL-2-LIKE PROTEIN 11;
4ZIGDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.20 Å
Title : BIDBH3MINIBIDBH3MINI
Classification : APOPTOSIS
Molecule : BH3-INTERACTING DOMAIN DEATH AGONIST;MOLECULE: BH3-INTERACTING DOMAIN DEATH AGONIST;
4ZIHDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.50 Å
Title : BIMBH3MINIBIMBH3MINI
Classification : APOPTOSIS
Molecule : BCL-2-LIKE PROTEIN 11;MOLECULE: BCL-2-LIKE PROTEIN 11;
4ZIIDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.19 Å
Title : BIDBH3BIDBH3
Classification : APOPTOSIS
Molecule : BH3-INTERACTING DOMAIN DEATH AGONIST;MOLECULE: BH3-INTERACTING DOMAIN DEATH AGONIST;
4ZIPDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.11 Å
Title : LIGAND)LIGAND)
Classification : HYDROLASE/HYDROLASE INHIBITOR
Molecule : PROTEASE;MOLECULE: PROTEASE;
4ZIXDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.89 Å
Title : PROTEINS IN LIPIDIC CUBIC PHASEPROTEINS IN LIPIDIC CUBIC PHASE
Classification : HYDROLASE
Molecule : LYSOZYME C;MOLECULE: LYSOZYME C;
4ZJMDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.85 Å
Title : CRYSTAL STRUCTURE OF MYCOBACTERIUM TUBERCULOSIS LPQH (RV3763)RYSTAL STRUCTURE OF MYCOBACTERIUM TUBERCULOSIS LPQH (RV3763)
Classification : UNKNOWN FUNCTION
Molecule : LIPOPROTEIN LPQH;MOLECULE: LIPOPROTEIN LPQH;
4ZKQDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.90 Å
Title : PERU ( RHVP)PERU ( RHVP)
Classification : CHEMOKINE BINDING PROTEIN
Molecule : PUTATIVE UNCHARACTERIZED PROTEIN;MOLECULE: PUTATIVE UNCHARACTERIZED PROTEIN;
4ZL4Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.37 Å
Title : (WEHI-842)(WEHI-842)
Classification : HYDROLASE/HYDROLASE INHIBITOR
Molecule : ASPARTIC PROTEASE PM5;MOLECULE: ASPARTIC PROTEASE PM5;
4ZLPDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.48 Å
Title : CRYSTAL STRUCTURE OF NOTCH3 NEGATIVE REGULATORY REGIONRYSTAL STRUCTURE OF NOTCH3 NEGATIVE REGULATORY REGION
Classification : TRANSCRIPTION
Molecule : NEUROGENIC LOCUS NOTCH HOMOLOG PROTEIN 3;MOLECULE: NEUROGENIC LOCUS NOTCH HOMOLOG PROTEIN 3;
4ZLTDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 3.00 Å
Title : WITH CCL3WITH CCL3
Classification : CHEMOKINE BINDING PROTEIN/CHEMOKINE
Molecule : C-C MOTIF CHEMOKINE 3;MOLECULE: C-C MOTIF CHEMOKINE 3;
4ZM9Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.51 Å
Title : PROTEIN 1PROTEIN 1
Classification : HYDROLASE
Molecule : ISOASPARTYL PEPTIDASE/L-ASPARAGINASE;MOLECULE: ISOASPARTYL PEPTIDASE/L-ASPARAGINASE;
4ZN6Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.05 Å
Title : REDUCTOISOMERASE (ISPC) FROM ACINETOBACTER BAUMANNIIREDUCTOISOMERASE (ISPC) FROM ACINETOBACTER BAUMANNII
Classification : OXIDOREDUCTASE
Molecule : 1-DEOXY-D-XYLULOSE 5-PHOSPHATE REDUCTOISOMERASE;MOLECULE: 1-DEOXY-D-XYLULOSE 5-PHOSPHATE REDUCTOISOMERASE;
4ZNPDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.94 Å
Title : THE STRUCTURE OF A PFI RIBOSWITCH BOUND TO ZMPHE STRUCTURE OF A PFI RIBOSWITCH BOUND TO ZMP
Classification : RNA
Molecule : PFI RIBOSWITCH;MOLECULE: PFI RIBOSWITCH;
4ZRODeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.06 Å
Title : 2.1 A X-RAY STRUCTURE OF FIPV-3CLPRO BOUND TO COVALENT INHIBITOR.1 A X-RAY STRUCTURE OF FIPV-3CLPRO BOUND TO COVALENT INHIBITOR
Classification : HYDROLASE/HYDROLASE INHIBITOR
Molecule : BOUNDED INHIBITOR OF N-(TERT-BUTOXYCARBONYL)-L-SERYL-L-MOLECULE: BOUNDED INHIBITOR OF N-(TERT-BUTOXYCARBONYL)-L-SERYL-L-
4ZRRDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.50 Å
Title : AT 1.5 A RESOLUTION USING A HOME SOURCE.AT 1.5 A RESOLUTION USING A HOME SOURCE.
Classification : TRANSFERASE
Molecule : BACTERIOPHYTOCHROME;MOLECULE: BACTERIOPHYTOCHROME;
4ZSTDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.01 Å
Title : L7EP-3AL7EP-3A
Classification : HYDROLASE
Molecule : PARATHION HYDROLASE;MOLECULE: PARATHION HYDROLASE;
4ZSWDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.70 Å
Title : FLUOROMETHYLENYL-1-CYCLOPENTANOIC ACIDFLUOROMETHYLENYL-1-CYCLOPENTANOIC ACID
Classification : TRANSFERASE/TRANSFERASE INHIBITOR
Molecule : 4-AMINOBUTYRATE AMINOTRANSFERASE, MITOCHONDRIAL;MOLECULE: 4-AMINOBUTYRATE AMINOTRANSFERASE, MITOCHONDRIAL;
4ZTHDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.15 Å
Title : USED IN INHIBITOR DISCOVERYUSED IN INHIBITOR DISCOVERY
Classification : TRANSFERASE
Molecule : MITOGEN-ACTIVATED PROTEIN KINASE 14;MOLECULE: MITOGEN-ACTIVATED PROTEIN KINASE 14;
4ZTKDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.10 Å
Title : PNEUMOPHILA.PNEUMOPHILA.
Classification : TRANSFERASE, CELL CYCLE
Molecule : CELL DIVISION PROTEIN FTSI/PENICILLIN BINDING PROTEIN 2;MOLECULE: CELL DIVISION PROTEIN FTSI/PENICILLIN BINDING PROTEIN 2;
4ZTODeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.30 Å
Title : TARGETING AN EPITOPE IN HIV-1 GP120 C4 REGIONTARGETING AN EPITOPE IN HIV-1 GP120 C4 REGION
Classification : IMMUNE SYSTEM
Molecule : EPITOPE OF RABBIT MONOCLONAL ANTIBODY R53;MOLECULE: EPITOPE OF RABBIT MONOCLONAL ANTIBODY R53;
4ZTPDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.63 Å
Title : IN HIV-1 GP120 C4 REGIONIN HIV-1 GP120 C4 REGION
Classification : IMMUNE SYSTEM
Molecule : HEAVY CHAIN OF FAB FRAGMENT OF RABBIT MONOCLONAL ANTIBODYMOLECULE: HEAVY CHAIN OF FAB FRAGMENT OF RABBIT MONOCLONAL ANTIBODY
4ZUDDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.80 Å
Title : INVERSE AGONIST OLMESARTAN AT 2.8A RESOLUTION.INVERSE AGONIST OLMESARTAN AT 2.8A RESOLUTION.
Classification : MEMBRANE PROTEIN
Molecule : CHIMERA PROTEIN OF SOLUBLE CYTOCHROME B562 AND TYPE-1MOLECULE: CHIMERA PROTEIN OF SOLUBLE CYTOCHROME B562 AND TYPE-1
4ZUYDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.95 Å
Title : STRUCTURE OF TSI6 FROM PSEUDOMONAS AERUGINOSATRUCTURE OF TSI6 FROM PSEUDOMONAS AERUGINOSA
Classification : PROTEIN BINDING
Molecule : TSI6;MOLECULE: TSI6;
4ZV0Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.40 Å
Title : STRUCTURE OF TSE6 IN COMPLEX WITH TSI6TRUCTURE OF TSE6 IN COMPLEX WITH TSI6
Classification : PROTEIN BINDING
Molecule : TSE6-BINDING/TSE6 IMMUNITY PROTEIN;MOLECULE: TSE6-BINDING/TSE6 IMMUNITY PROTEIN;
4ZV4Deposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 3.50 Å
Title : STRUCTURE OF TSE6 IN COMPLEX WITH EF-TUTRUCTURE OF TSE6 IN COMPLEX WITH EF-TU
Classification : TRANSLATION
Molecule : TSE6;MOLECULE: TSE6;
4ZVODeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.85 Å
Title : TO Y230V/W232Y/S234V/Q276D SUBSTITUTIONS BOUND TO VEID INHIBITOR.TO Y230V/W232Y/S234V/Q276D SUBSTITUTIONS BOUND TO VEID INHIBITOR.
Classification : HYDROLASE/HYDROLASE INHIBITOR
Molecule : PEPTIDE ACE-VAL-GLU-ILE-ASJ;MOLECULE: PEPTIDE ACE-VAL-GLU-ILE-ASJ;
4ZVPDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.50 Å
Title : TO Y230V/W232M/Q276C SUBSTITUTIONS BOUND TO DEVD INHIBITOR.TO Y230V/W232M/Q276C SUBSTITUTIONS BOUND TO DEVD INHIBITOR.
Classification : HYDROLASE/HYDROLASE INHIBITOR
Molecule : PEPTIDE ACE-ASP-GLU-VAL-ASA;MOLECULE: PEPTIDE ACE-ASP-GLU-VAL-ASA;
4ZVQDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.50 Å
Title : TO Y230V/W232M/Q276C SUBSTITUTIONS BOUND TO VEID INHIBITOR.TO Y230V/W232M/Q276C SUBSTITUTIONS BOUND TO VEID INHIBITOR.
Classification : HYDROLASE/HYDROLASE INHIBITOR
Molecule : PEPTIDE ACE-VAL-GLU-ILE-ASA;MOLECULE: PEPTIDE ACE-VAL-GLU-ILE-ASA;
4ZVRDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.30 Å
Title : TO Y230V/W232Y/S234V/Q276D SUBSTITUTIONS BOUND TO DEVD INHIBITOR.TO Y230V/W232Y/S234V/Q276D SUBSTITUTIONS BOUND TO DEVD INHIBITOR.
Classification : HYDROLASE/HYDROLASE INHIBITOR
Molecule : PEPTIDE ACE-ASP-GLU-VAL-ASJ;MOLECULE: PEPTIDE ACE-ASP-GLU-VAL-ASJ;
4ZVSDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.50 Å
Title : TO Y230A/W232M/S234N SUBSTITUTIONS, BOUND TO DEVD INHIBITOR.TO Y230A/W232M/S234N SUBSTITUTIONS, BOUND TO DEVD INHIBITOR.
Classification : HYDROLASE/HYDROLASE INHIBITOR
Molecule : DEVD INHIBITOR;MOLECULE: DEVD INHIBITOR;
4ZVTDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.85 Å
Title : TO Y230A/W232M/S234N SUBSTITUTIONS, BOUND TO VEID INHIBITOR.TO Y230A/W232M/S234N SUBSTITUTIONS, BOUND TO VEID INHIBITOR.
Classification : HYDROLASE/HYDROLASE INHIBITOR
Molecule : VEID INHIBITOR;MOLECULE: VEID INHIBITOR;
4ZVUDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.60 Å
Title : INHIBITOR AC-VEID-CHOINHIBITOR AC-VEID-CHO
Classification : HYDROLASE/HYDROLASE INHIBITOR
Molecule : TETRAPEPTIDE INHIBITOR AC-VEID-CHO;MOLECULE: TETRAPEPTIDE INHIBITOR AC-VEID-CHO;
4ZWEDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.81 Å
Title : MUTANTMUTANT
Classification : HYDROLASE
Molecule : DEOXYNUCLEOSIDE TRIPHOSPHATE TRIPHOSPHOHYDROLASE SAMHD1;MOLECULE: DEOXYNUCLEOSIDE TRIPHOSPHATE TRIPHOSPHOHYDROLASE SAMHD1;
4ZWGDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.30 Å
Title : PHOSPHOMIMETIC T592E MUTANTPHOSPHOMIMETIC T592E MUTANT
Classification : HYDROLASE
Molecule : DEOXYNUCLEOSIDE TRIPHOSPHATE TRIPHOSPHOHYDROLASE SAMHD1;MOLECULE: DEOXYNUCLEOSIDE TRIPHOSPHATE TRIPHOSPHOHYDROLASE SAMHD1;
4ZWIDeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 1.60 Å
Title : A SULFAMATE-BASED INHIBITORA SULFAMATE-BASED INHIBITOR
Classification : LYASE/LYASE INHIBITOR
Molecule : CARBONIC ANHYDRASE 2;MOLECULE: CARBONIC ANHYDRASE 2;
4ZWODeposited : 20-SEP-17  (Revised)     Exp.Method :X-RAY DIFFRACTION with the resolution of 2.14 Å
<
Title : Y212FY212F
Classification :